ID: 1014127331

View in Genome Browser
Species Human (GRCh38)
Location 6:117791977-117791999
Sequence ACTCTTGCACCCGAGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014127326_1014127331 21 Left 1014127326 6:117791933-117791955 CCAGTGATTCCACTTTGTACTTC No data
Right 1014127331 6:117791977-117791999 ACTCTTGCACCCGAGTGCAGGGG No data
1014127327_1014127331 12 Left 1014127327 6:117791942-117791964 CCACTTTGTACTTCTGAAGTACA No data
Right 1014127331 6:117791977-117791999 ACTCTTGCACCCGAGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014127331 Original CRISPR ACTCTTGCACCCGAGTGCAG GGG Intergenic
No off target data available for this crispr