ID: 1014127785

View in Genome Browser
Species Human (GRCh38)
Location 6:117796263-117796285
Sequence CTATGCAAATCTAGTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014127783_1014127785 6 Left 1014127783 6:117796234-117796256 CCTATGCACATCAGCAGGAGGCA No data
Right 1014127785 6:117796263-117796285 CTATGCAAATCTAGTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014127785 Original CRISPR CTATGCAAATCTAGTAAAGT TGG Intergenic
No off target data available for this crispr