ID: 1014137631

View in Genome Browser
Species Human (GRCh38)
Location 6:117907511-117907533
Sequence GAGGGTGCGCGCACTGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014137623_1014137631 11 Left 1014137623 6:117907477-117907499 CCGGGGCGGGCGGCGGCGGCGGC 0: 2
1: 43
2: 125
3: 419
4: 1307
Right 1014137631 6:117907511-117907533 GAGGGTGCGCGCACTGGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014137631 Original CRISPR GAGGGTGCGCGCACTGGGAC TGG Exonic