ID: 1014137631 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:117907511-117907533 |
| Sequence | GAGGGTGCGCGCACTGGGAC TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 109 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 102} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014137623_1014137631 | 11 | Left | 1014137623 | 6:117907477-117907499 | CCGGGGCGGGCGGCGGCGGCGGC | 0: 2 1: 43 2: 125 3: 419 4: 1307 |
||
| Right | 1014137631 | 6:117907511-117907533 | GAGGGTGCGCGCACTGGGACTGG | 0: 1 1: 0 2: 0 3: 6 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014137631 | Original CRISPR | GAGGGTGCGCGCACTGGGAC TGG | Exonic | ||