ID: 1014138916

View in Genome Browser
Species Human (GRCh38)
Location 6:117918711-117918733
Sequence CTGTTTAGAATCTGCGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014138916 Original CRISPR CTGTTTAGAATCTGCGACCT TGG Intronic
901353918 1:8626038-8626060 TTATTTAGCATCTGGGACCTTGG - Intronic
908544796 1:65151665-65151687 CTGTCTAGAATTTGTGACCCAGG - Intronic
914049484 1:144119633-144119655 CTGTTTAGAATCATCAACATTGG + Intergenic
914129698 1:144845807-144845829 CTGTTTAGAATCATCAACATTGG - Intergenic
918726309 1:187928929-187928951 GTGTAGAGAATTTGCGACCTTGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
924700122 1:246442854-246442876 CTGGTAAGAATCTGTGCCCTGGG + Intronic
1064822981 10:19360307-19360329 CTGTTTATTTTCTGCTACCTAGG + Intronic
1071987878 10:91070950-91070972 CTGGTTAGAAGCTGAGACCTGGG + Intergenic
1074239526 10:111623219-111623241 TTGTTTAGAGACTGCAACCTTGG - Intergenic
1074995744 10:118755481-118755503 CCGTTTATAACCTGCGACCCCGG - Intergenic
1075711332 10:124532260-124532282 CTGTTTAGAATCTCAGCCCAGGG + Intronic
1077587068 11:3462022-3462044 CAGTTTGGGATCTGAGACCTTGG - Intergenic
1079876316 11:25861603-25861625 CTGTTTAGATTCTGTCACTTTGG + Intergenic
1084829926 11:71760908-71760930 CAGTTTGGGATCTGAGACCTTGG + Intergenic
1092413309 12:8270769-8270791 CAGTTTGGGATCTGAGACCTTGG - Intergenic
1093672325 12:21891803-21891825 CTGTTTATAATCGGAGACTTTGG - Intronic
1093777826 12:23097934-23097956 CTGTTTATAATGTGCCCCCTGGG - Intergenic
1101832147 12:108266993-108267015 CTGTTTTGAATCACCGACCTAGG - Intergenic
1110274096 13:73623750-73623772 CTGCTGAGAATCTGCAACCCGGG + Intergenic
1111427734 13:88110188-88110210 CTGTTAAGAAACTGAGACTTAGG + Intergenic
1118110459 14:62712534-62712556 CTGTTTGGAATCTGACCCCTTGG - Intronic
1123446506 15:20334634-20334656 CTGTTTAGAATCACCAACATTGG - Intergenic
1123727076 15:23113805-23113827 CTGTCAAGAATCAGCGAGCTTGG - Intergenic
1126245910 15:46505386-46505408 TTGTATAGAATATGTGACCTTGG - Intergenic
1127321879 15:57855039-57855061 GTGTTTAGCATGTGCAACCTTGG + Intergenic
1129806104 15:78459423-78459445 CGGTGTAGAATCTGCCTCCTGGG + Intronic
1132168274 15:99619390-99619412 GTATTTAGCATCTGCGACCTTGG + Intronic
1133354520 16:5126274-5126296 CAGTTTGGGATCTGAGACCTTGG - Intergenic
1134454536 16:14384965-14384987 GTGTTTAGAATCCCAGACCTGGG - Intergenic
1140824625 16:78694312-78694334 CTGTCTACAAGCTGCGACCATGG + Intronic
1142386881 16:89770934-89770956 CTCTTTAGAATATGCGACAGAGG - Intronic
1143812801 17:9486182-9486204 CTGTTTGGAATCTAAGATCTTGG - Intronic
1144292076 17:13836401-13836423 ATGTTTTGAATCTGTGTCCTTGG - Intergenic
1144324408 17:14164709-14164731 CCGTTTAGAGTATGTGACCTTGG + Intronic
1156692171 18:39721314-39721336 CTACTTAGAATCTGTGACCTTGG - Intergenic
1159507806 18:69359014-69359036 CTGTTTAGAATCTGCTACAGAGG - Intergenic
1164822428 19:31260412-31260434 GGGTTCAGAATCTGAGACCTGGG + Intergenic
1167242788 19:48354924-48354946 CTGTTTAAAATCTCCTGCCTGGG + Intronic
1202688874 1_KI270712v1_random:72201-72223 CTGTTTAGAATCATCAACATTGG + Intergenic
927198819 2:20566038-20566060 CTGTTTGCTAACTGCGACCTTGG - Intronic
931966815 2:67544244-67544266 CTGTTTAGGTTCTGCTACCAAGG + Intergenic
932523491 2:72439035-72439057 CTGCTTAGAAGCTGTTACCTTGG + Intronic
933957561 2:87383898-87383920 CTGTTTAGAATCATCAACATTGG - Intergenic
934241681 2:90275793-90275815 CTGTTTAGAATCATCAACATTGG - Intergenic
934271492 2:91540892-91540914 CTGTTTAGAATCATCAACATTGG + Intergenic
940267227 2:151851478-151851500 CTGTTTGAAATCTCTGACCTGGG + Intronic
944052977 2:195492214-195492236 CATTTTAGAATCTGCTTCCTAGG + Intergenic
947677744 2:231999302-231999324 GTGTTTAGAAACTGAGATCTAGG + Intronic
1175391380 20:58629543-58629565 CTGTTTAGAAACTCCAACCCTGG - Intergenic
1180552549 22:16552396-16552418 CTGTTTAGAATCATCAACATTGG - Intergenic
1181351484 22:22261636-22261658 CTGTTTAGAATCATCAACATTGG + Intergenic
1182787729 22:32921569-32921591 CGGTATAGAATCAGAGACCTGGG + Intronic
1182833632 22:33323929-33323951 CAGTTTAGAAACTGCCTCCTTGG + Intronic
951051332 3:18097194-18097216 CTGTTAAGAAGCTATGACCTGGG - Intronic
952621641 3:35350877-35350899 ATGTTTAGACTCTGTGATCTTGG + Intergenic
952691421 3:36210924-36210946 CTGTTTAGAATTTTTCACCTTGG - Intergenic
953820974 3:46207170-46207192 CTGTTCAGAATGTGGGGCCTGGG - Intronic
957058409 3:75461959-75461981 CAGTTTGGGATCTGAGACCTTGG - Intergenic
957651331 3:83009089-83009111 CTGTTTAGAATAAACTACCTGGG - Intergenic
960202128 3:114849712-114849734 GTGTATATAATCTGTGACCTAGG - Intronic
961890864 3:130129421-130129443 CAGTTTGGGATCTGAGACCTTGG - Intergenic
967626757 3:191695173-191695195 CTGTGCAGAACCTGCAACCTAGG + Intergenic
968772359 4:2515681-2515703 CTATTCAGAAACTGCGAACTAGG + Exonic
969002257 4:3991839-3991861 CAGTTTGGGATCTGAGACCTTGG - Intergenic
969751756 4:9116675-9116697 CAGTTTGGGATCTGAGACCTTGG + Intergenic
977436513 4:97003037-97003059 CTGTTTATCATGTGTGACCTTGG + Intergenic
981688714 4:147482377-147482399 CTGTTTGGAATCTGAGAGTTTGG - Intronic
983934210 4:173488531-173488553 CTGTGTAGAAACTGCTATCTGGG + Intergenic
983978835 4:173969006-173969028 CTGTTTATATTCAGCCACCTTGG + Intergenic
988024295 5:25665443-25665465 CTGTTTTGAATTTGCCACTTTGG - Intergenic
989511299 5:42290362-42290384 ATGTGAAGAATCTGAGACCTAGG - Intergenic
998920329 5:147060793-147060815 CTGTTTAGTATCTGACACCCTGG + Intronic
999072328 5:148759081-148759103 CTGCTTAGAGTCTCCGACCATGG - Intergenic
1000906796 5:166974120-166974142 CTGTTGAGACTGTGTGACCTGGG + Intergenic
1004057879 6:12159120-12159142 CTGTTGATTATCTGGGACCTCGG + Intronic
1006687828 6:35852185-35852207 CTGTTTAGAATGTCTGACTTGGG + Intronic
1010119802 6:72362181-72362203 CTATTCAGAAACTGTGACCTAGG - Intronic
1010701703 6:79056726-79056748 CTGGTTAGAATCTGACTCCTAGG + Intronic
1011782029 6:90800287-90800309 CTTTTTAGAAGCTGGGACCCAGG + Intergenic
1014138916 6:117918711-117918733 CTGTTTAGAATCTGCGACCTTGG + Intronic
1016154093 6:140781934-140781956 CTATTTAGAATCTATGACATAGG + Intergenic
1019672141 7:2286310-2286332 CTGTTTAAAGTATACGACCTAGG - Intronic
1026118917 7:67519530-67519552 CTGTAAAGAATCTGCTTCCTGGG + Intergenic
1027433429 7:78138056-78138078 CTGTTTGGCATATGTGACCTTGG - Intronic
1031121894 7:117731412-117731434 CTGTGTAGGATTTGGGACCTTGG - Intronic
1032208994 7:129894893-129894915 CAGTTTAAAATCTGCAAACTTGG + Intronic
1033300318 7:140178900-140178922 CTTTCTATAATCTGTGACCTCGG + Intergenic
1036374962 8:8192105-8192127 CAGTTTGGGATCTGAGACCTTGG + Intergenic
1036854581 8:12231046-12231068 CAGTTTGGGATCTGAGACCTTGG - Intergenic
1036875940 8:12473539-12473561 CAGTTTGGGATCTGAGACCTTGG - Intergenic
1037638151 8:20719120-20719142 CTGTTTAGAATCTGGAACTAAGG - Intergenic
1038580779 8:28747423-28747445 CAGTTTAAACTCTGGGACCTGGG + Intronic
1042629845 8:70804989-70805011 CTGTTTCTAGTCTGCGATCTTGG - Intergenic
1042985604 8:74579762-74579784 CAGTTTAGTAGCTGTGACCTTGG + Intergenic
1047984997 8:130223557-130223579 CTGTTTATAAACTGTGATCTAGG + Intronic
1057782987 9:98065031-98065053 CAGTTTCAAATCTGAGACCTGGG + Intronic
1058487016 9:105451813-105451835 CTTTTTAGAATCTTGGAGCTTGG + Intronic
1058615336 9:106820855-106820877 TTGATTAGAGTCTGCCACCTTGG + Intergenic
1185532731 X:834718-834740 CTGTTTAGAATCATCAACATTGG - Intergenic
1186937278 X:14463980-14464002 CTGTTCCTAATCTGCCACCTTGG + Intergenic
1187501998 X:19846524-19846546 CTTTTTTGAATCTGAGAACTAGG - Intronic
1195763877 X:108275912-108275934 CTGTTTAGTGTCTGTGACTTTGG - Intronic
1199506279 X:148564843-148564865 CTGTGTGGAATGTGCTACCTAGG - Intronic