ID: 1014140782

View in Genome Browser
Species Human (GRCh38)
Location 6:117939626-117939648
Sequence CCCTTTAGGTCCTTTTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014140782_1014140790 24 Left 1014140782 6:117939626-117939648 CCAGTTAAAAAGGACCTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1014140790 6:117939673-117939695 ACATCTTACTGTGGAGTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 176
1014140782_1014140789 15 Left 1014140782 6:117939626-117939648 CCAGTTAAAAAGGACCTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1014140789 6:117939664-117939686 ATAACAAGGACATCTTACTGTGG 0: 1
1: 0
2: 0
3: 16
4: 170
1014140782_1014140786 1 Left 1014140782 6:117939626-117939648 CCAGTTAAAAAGGACCTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1014140786 6:117939650-117939672 ATAAACCCGGAAATATAACAAGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014140782 Original CRISPR CCCTTTAGGTCCTTTTTAAC TGG (reversed) Intronic
907295712 1:53451728-53451750 CCATTTAGGGCCTTTTTAATGGG - Intergenic
908190649 1:61700274-61700296 CTCTTTAAATCCTCTTTAACAGG - Intronic
911872217 1:103112425-103112447 TATTTTAGGTCCTTTTAAACAGG - Intergenic
915519107 1:156430982-156431004 CCCGTTAGCTCCTTTCTCACCGG + Intergenic
916244579 1:162674793-162674815 CTCTCTAGGACCTCTTTAACTGG + Intronic
921197508 1:212773351-212773373 TCCTTTACCTTCTTTTTAACAGG - Intronic
921540126 1:216404138-216404160 CCATTTAGGTCCTCTTTTATTGG - Intronic
1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG + Intergenic
1065860536 10:29868877-29868899 CCTTTGAGGTCCTTTTGAATGGG - Intergenic
1065912546 10:30321665-30321687 CTCTTAAGGTCATTTTAAACAGG + Intronic
1068001322 10:51337578-51337600 CCCTTCATGTCCTTTTTAATGGG - Intronic
1068686847 10:59879212-59879234 CCCTTTAGATCCTTGTTTTCAGG - Intronic
1077827036 11:5821913-5821935 CCATTTAGATCCATTTTAAATGG - Intronic
1078410966 11:11117656-11117678 CTTTCTAGGTCATTTTTAACTGG - Intergenic
1080898155 11:36462862-36462884 CCCCTTAGGTCATTTTGACCAGG - Exonic
1087725931 11:101716578-101716600 CCCTTCAGGCCCTATTTTACAGG + Intronic
1087777629 11:102271078-102271100 CCCTTTGTGTCCATTTTAAATGG + Intergenic
1088275459 11:108080692-108080714 CCCTTTTGGCCATTTTTAATTGG + Intronic
1091027296 11:132153127-132153149 CCCCTTAGGTGCTTTTCCACAGG + Intronic
1091129963 11:133137719-133137741 ACCTTTAGGTTCTTTTTCCCAGG - Intronic
1096720686 12:53519244-53519266 CAGTTTAGGGGCTTTTTAACTGG + Intronic
1097030966 12:56088986-56089008 TCTTTCAGGTCCTTTGTAACAGG - Intronic
1101066629 12:101028030-101028052 CACTTTAGGCCCTATTTATCTGG - Intronic
1102443410 12:112981038-112981060 CCCTTTGGCTGCTTTTTAATGGG + Intronic
1105230199 13:18487409-18487431 CCATTTATGTTCTTTATAACAGG + Intergenic
1107942339 13:45386002-45386024 CCCTTTAGGAGCTTTGTAGCGGG - Intergenic
1110103915 13:71646014-71646036 CTCTTTTGGTCCTGTTAAACAGG - Intronic
1111715559 13:91875331-91875353 CACGTTAGGTACTTTTAAACAGG + Intronic
1113380696 13:109803023-109803045 CTCTCAAGGTCCTTTTTAAGGGG - Intergenic
1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG + Intronic
1120272183 14:82326834-82326856 TTCTTTAGGTCCTTTTTTAGGGG + Intergenic
1129324694 15:74793910-74793932 ACCTTTAGGTCCTTCTGAATAGG - Intronic
1131954726 15:97721227-97721249 CCCTTTACATCCTTTCTTACTGG - Intergenic
1133159379 16:3899962-3899984 CCCTTTTGTTCATTTTTAACTGG - Intergenic
1138803354 16:60062213-60062235 TCTTTTTGTTCCTTTTTAACTGG + Intergenic
1142097926 16:88253837-88253859 CCCTTTTGTCCATTTTTAACAGG + Intergenic
1145847454 17:28053901-28053923 CCCTTTGGGTACTTTTGTACTGG - Intronic
1150295045 17:64002967-64002989 CCCTTTTGGTCCCTGGTAACTGG - Intronic
1154098933 18:11450253-11450275 CCCTTTTGCCCATTTTTAACAGG - Intergenic
1154523204 18:15252432-15252454 CCATTTATGTTCTTTATAACAGG - Intergenic
1160616410 18:80133091-80133113 CCTTTAAGGTCCTTTTAAAAAGG - Exonic
1165098579 19:33424543-33424565 GCCTTCTGGTCCTTTTTAAAAGG - Intronic
1166299270 19:41904958-41904980 CCTTCTACGTCCTTTTTACCTGG + Exonic
926182797 2:10660670-10660692 CCATTTATAACCTTTTTAACTGG + Intronic
927033479 2:19147498-19147520 ACATTTTGGTCCGTTTTAACAGG + Intergenic
932478260 2:72022678-72022700 TCCTTTATGTCCTTTCTCACAGG - Intergenic
933003658 2:76960015-76960037 GCCCTTAGGCCCTTTTTAACAGG - Intronic
933786013 2:85842171-85842193 CTGTTGAGTTCCTTTTTAACAGG - Intronic
934865936 2:97811283-97811305 CCCTTCATGTCCATTTTAATAGG - Intronic
935868533 2:107419130-107419152 CCCTAAAGGTCTTTTTTAAACGG + Intergenic
937786268 2:125902854-125902876 CTCTTTAGCTTCTCTTTAACTGG + Intergenic
938522509 2:132085304-132085326 CCATTTATGTTCTTTATAACAGG - Intergenic
943674849 2:190706786-190706808 CCCTTAAGTTCCTTTTTGTCTGG - Intergenic
943969162 2:194381188-194381210 CCCTTAAGGTCCAGTTAAACAGG - Intergenic
944692362 2:202169719-202169741 CACTTGAGGACCTTGTTAACAGG - Intronic
946752758 2:222909196-222909218 CCCTTTACTTCATTTCTAACAGG - Intronic
948519098 2:238524288-238524310 TCCTTTTGGTCCTTGTTAGCTGG - Intergenic
1170315685 20:15039035-15039057 CCTATTAGGTCCTTTGTTACAGG - Intronic
1172966955 20:38842784-38842806 CACTTTTGGTCCTTTTAAAAAGG + Intronic
1173324566 20:42020741-42020763 CTCTTTAGGTACTTTTTTCCTGG - Intergenic
1176774184 21:13115754-13115776 CCATTTATGTTCTTTATAACAGG + Intergenic
1178870699 21:36372720-36372742 CCCTTTAGGTTCTATTTAAGTGG + Intronic
1179244592 21:39620580-39620602 CCCTTTAGCTCCCTTTTCATTGG - Intronic
1180521804 22:16215477-16215499 CCATTTATGTTCTTTATAACAGG + Intergenic
1183768268 22:39899680-39899702 CCCTGTAGCTCCTTAATAACAGG - Intergenic
951243197 3:20310956-20310978 CCCTTTGGTTCTTTTTAAACTGG - Intergenic
951927372 3:27923008-27923030 TCCTTGATTTCCTTTTTAACTGG + Intergenic
954886493 3:53879656-53879678 ACATTCAGGTCCTTGTTAACAGG - Intronic
956547980 3:70427437-70427459 CCCTTTTGGACATTTTTAAGAGG - Intergenic
959404633 3:105945321-105945343 CACTTCAGGTCATTTTTAAGTGG - Intergenic
961043082 3:123691090-123691112 CTCTTTAGGTCCTGTTTACATGG - Intronic
965624254 3:170671404-170671426 CCCTAGAGGTTCCTTTTAACTGG + Intronic
972013418 4:34213491-34213513 TCCTTTGCGTACTTTTTAACGGG - Intergenic
973028243 4:45301925-45301947 TCCTTTGCGTACTTTTTAACAGG - Intergenic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
975181874 4:71355338-71355360 TCCTTTAAGTCCTTTTAAAGTGG - Intronic
975289307 4:72658365-72658387 CCCTTTAAGTTCTTTGTAAAAGG + Intergenic
975444792 4:74449984-74450006 ACCTTTAGGTCCTTTTTTAAAGG - Intronic
977234476 4:94491471-94491493 TCTTTTAGGGCCTTGTTAACTGG + Intronic
980277016 4:130666010-130666032 CTCTTTTGGTCATTTTTAACTGG - Intergenic
981318212 4:143362561-143362583 CCCCTTAGGGTCTTTTTAAAAGG - Intronic
983651600 4:170041602-170041624 CCCTTTTGCTACTTTTTAACTGG + Intergenic
988857866 5:35246870-35246892 CCCTTTTGGTCCCTATGAACTGG - Intergenic
990346141 5:54873639-54873661 CCATTTTGATCCCTTTTAACAGG + Intergenic
992339885 5:75812615-75812637 CCCTCTTTGTCTTTTTTAACTGG + Intergenic
994090437 5:95805294-95805316 CCCTCTGGGTCCTCTTTAAAAGG + Intronic
998964258 5:147521733-147521755 CCCTTTTGGTACTATTTAGCAGG - Intergenic
1001405983 5:171477976-171477998 CCCCTTAGGGCCTCTCTAACTGG - Intergenic
1002884271 6:1280214-1280236 CTCTGTAGGTCCTTTTTATAAGG - Intergenic
1007796825 6:44355785-44355807 CTCTTTAGGTCCTCTGCAACAGG + Intronic
1011944269 6:92881102-92881124 CACTTTAGGTCCTGTTTATCTGG - Intergenic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1016847445 6:148582399-148582421 CTGTTTATGTCCTTTTTAATGGG + Intergenic
1024790402 7:52959173-52959195 CACTTAAGGTGCTTTTAAACAGG - Intergenic
1025820816 7:64961377-64961399 CCCTCTTTGTCCTTTTTAACTGG - Intergenic
1032759051 7:134920891-134920913 CTCTTTAAGTCTTTTATAACTGG + Intronic
1034617429 7:152430831-152430853 TCCTTAATGTCCTTTATAACTGG + Intronic
1038728731 8:30106737-30106759 CCATGTATGTCCATTTTAACAGG - Intronic
1042009377 8:64223200-64223222 CCCTTTACTCCCTTTTTAAAAGG - Intergenic
1042406521 8:68411985-68412007 TACTTCAGGTCCTTTTTAAGGGG - Intronic
1046419587 8:113962243-113962265 CTCTTTATGTCCTTTATGACAGG - Intergenic
1047768391 8:128009434-128009456 CCCTTTGGGTGCAATTTAACAGG - Intergenic
1050951398 9:11600283-11600305 CCCTTTAAGTCATGTTTACCTGG + Intergenic
1051076684 9:13246698-13246720 CACTTTGGGTTTTTTTTAACTGG + Intronic
1056519993 9:87392004-87392026 CCCTTTAGGTTCTTTTGCAGAGG - Intergenic
1058414482 9:104772049-104772071 CCCTTTACCTACTTTTTAATGGG + Intronic
1062227847 9:135463760-135463782 GACTTTATGTCCTTTTTAAGAGG + Intergenic
1062738646 9:138153303-138153325 CCCCTGGGGTCCTTTTTAAGTGG + Intergenic
1188637057 X:32446844-32446866 CCATTTTAGTCCTTTTTCACTGG - Intronic
1189341182 X:40205815-40205837 CCCTCTTGCTCCTTTTTAGCAGG - Intergenic
1193061374 X:77211738-77211760 CCCATTAGATTCTTTTTTACTGG + Intergenic
1194533368 X:95077336-95077358 CCATTTTGGTCTTTTATAACAGG - Intergenic
1195957690 X:110350303-110350325 CTCTATAGGTGCTTTTTATCAGG - Intronic
1197636377 X:128919366-128919388 GCCTTTAAGACCTTTATAACTGG - Intergenic
1198154307 X:133943653-133943675 CCCTTCAGGTCCTTGTGAAAGGG + Intronic
1198420959 X:136470459-136470481 CCCTTCAGGGCCTCTTTTACAGG + Intergenic