ID: 1014141815

View in Genome Browser
Species Human (GRCh38)
Location 6:117952386-117952408
Sequence ATCCTTTAGCATTCAGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014141815_1014141818 4 Left 1014141815 6:117952386-117952408 CCATAGCCTGAATGCTAAAGGAT 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1014141818 6:117952413-117952435 TTGCTTCTTTCAGAAAATGCTGG 0: 1
1: 0
2: 4
3: 37
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014141815 Original CRISPR ATCCTTTAGCATTCAGGCTA TGG (reversed) Intronic
900272641 1:1799851-1799873 ATCCTTTCGCTTTCTGGCTGTGG - Intronic
902992539 1:20199232-20199254 AGCCGTTAGCATTCAGTCTGAGG + Intergenic
906288767 1:44605732-44605754 ATCCTTTAGGATGCAACCTAGGG - Intronic
906836522 1:49088370-49088392 ATCCTTTTACTTTTAGGCTATGG - Intronic
908328186 1:63044237-63044259 ATCCTTGAGACCTCAGGCTAGGG + Intergenic
912137321 1:106677457-106677479 AGTCTTTTGCAATCAGGCTATGG - Intergenic
913133967 1:115869316-115869338 ATCCTATAGCACTTAGACTATGG - Intergenic
913460227 1:119077428-119077450 AGCCTTTAGCACTAATGCTAAGG - Intronic
913519166 1:119629804-119629826 AACCTTTAGCAGCAAGGCTAGGG - Intronic
915181006 1:154059875-154059897 ATCCTTTGGCATACTGACTATGG + Intronic
915481013 1:156185088-156185110 CTTCTTTAGCATTCAGTCTGGGG + Intergenic
915697913 1:157762946-157762968 GTCCTTTCGCTTTCAGGCTTAGG - Intronic
917422257 1:174876659-174876681 ATCTTTTATCTTTAAGGCTAGGG - Intronic
917692901 1:177487364-177487386 ATACCATAACATTCAGGCTATGG - Intergenic
917699593 1:177566923-177566945 ATCTTTTAGGATTCAGTATATGG + Intergenic
918090368 1:181288213-181288235 TTCCTTAAGCACTCAGCCTATGG - Intergenic
919910557 1:202108057-202108079 ATCCTTGAACATGCAGGCTCTGG - Intergenic
920118739 1:203639616-203639638 GCCCTTTACCATTCAGGCCATGG - Intronic
920415017 1:205793364-205793386 ATCCTTTCCAATTCAGGCCAAGG + Intronic
924410485 1:243799535-243799557 ATTCTTCAACATTCAGACTAGGG + Intronic
1070195866 10:74155969-74155991 ATCCTTTAAGATTAAGGCTTTGG + Intronic
1075331391 10:121576764-121576786 GTCCCTTAGCAGTAAGGCTATGG + Intronic
1077432471 11:2522665-2522687 ATCATTTAGCCTTCAGAATATGG + Intronic
1078700940 11:13682110-13682132 ATCCTTTTGCATTCAGCCTCTGG + Intronic
1082822197 11:57551712-57551734 ATCCTCCAGCATTCAGTCCAGGG - Exonic
1085220324 11:74868619-74868641 ATCCGTTTGCTTTCAGCCTATGG - Intronic
1086942047 11:92808593-92808615 ATCTTTTAGCTTCCTGGCTATGG - Intronic
1087069735 11:94066213-94066235 CTACTTCAGCATACAGGCTAGGG - Intronic
1087694530 11:101361530-101361552 AGCCTTGAGTATTGAGGCTAGGG + Intergenic
1088283114 11:108156801-108156823 ATCCATCAGCATTCATGCAAAGG - Intergenic
1091521626 12:1250333-1250355 ATGATTAAACATTCAGGCTAAGG - Intronic
1094053719 12:26247293-26247315 ATCATTTATTATTCAGGTTAAGG - Intronic
1101491111 12:105210376-105210398 ATCTTTTAGCATTCAGGTTTAGG + Intronic
1104093886 12:125538569-125538591 ATCATTAAGCATTCAGCCCACGG - Intronic
1104300674 12:127562471-127562493 ATCCTGTAGCATCCATGCCATGG + Intergenic
1108319863 13:49279146-49279168 AGCCTTTACCATTAAGGTTAAGG + Intronic
1110669583 13:78161625-78161647 ATCCTTTTCCTTTCATGCTATGG - Intergenic
1116296912 14:43122799-43122821 ATATTTTAGCAATCAGGGTATGG - Intergenic
1117789118 14:59319951-59319973 ATCATTTAGAAATCAGGATATGG - Intronic
1129939535 15:79482177-79482199 ATGCTTTAGCAATAGGGCTAAGG + Intergenic
1130056230 15:80528254-80528276 ATGCTTAAGCATTCAGACTCTGG - Intronic
1130059397 15:80558850-80558872 ATCGTTTAGCAGTCAGGTTTGGG + Intronic
1130990572 15:88873422-88873444 ATCCTTTGGCTTTCAGTCTGTGG + Intronic
1135579108 16:23610138-23610160 ATCCATTTGCATACAGTCTATGG + Intronic
1139065048 16:63302311-63302333 ATGCTTAAGACTTCAGGCTAGGG + Intergenic
1140317232 16:73910856-73910878 AACCAGTAGCATTCATGCTATGG + Intergenic
1140852867 16:78951286-78951308 TTCCCTGAGCATTAAGGCTATGG - Intronic
1145409194 17:22641401-22641423 AAGCTTTAGCATTCATGCTTAGG + Intergenic
1147774304 17:42889859-42889881 ATCCTATAGAATACAGGCCAAGG - Intergenic
1158710008 18:59829168-59829190 ATCCTTTAGAATGAAGGCCATGG - Intergenic
1163160023 19:15458707-15458729 TTCCTCTACCCTTCAGGCTATGG - Intronic
1163522981 19:17802988-17803010 ATCCTTTAACACCCAGGCTCAGG - Intronic
930250922 2:49033365-49033387 ATCCTTTAGAATCCATGCTCAGG - Intronic
937757904 2:125563074-125563096 ATCCTTTACCAGTCAAGGTATGG + Intergenic
940158184 2:150681447-150681469 ATCATTTATCAGTCAGGGTAAGG + Intergenic
942473214 2:176284687-176284709 CTCCTTAAGCATTGTGGCTATGG - Intronic
946546051 2:220745050-220745072 ATCCTTTAGAATTTAGCCTTTGG - Intergenic
1175198460 20:57262603-57262625 AGCCTTCAGAATTCAGGCAAGGG + Intronic
1176688469 21:9875866-9875888 ATCCTTTGAAATTCAGGCTGAGG + Intergenic
949332884 3:2941719-2941741 TTCCATTACCATTCTGGCTATGG - Intronic
955475463 3:59331601-59331623 ATCCTTTGGTTTTCAGGCAATGG - Intergenic
955567808 3:60268237-60268259 CTCCTATAGCATTTAGGCTGAGG + Intronic
956882589 3:73526265-73526287 ATCTTTTAGTATTGAGGCTGTGG - Intronic
966489743 3:180515069-180515091 TTCCTGTAGCCTTCAGGATATGG - Intergenic
967238093 3:187407816-187407838 ATCTTTTATGATTCAGACTAAGG + Intergenic
977652139 4:99483067-99483089 ATCCTTTAACTTTGAGCCTATGG + Intergenic
978003313 4:103584236-103584258 ATCCTTTAGCATTTTGTATAGGG + Intergenic
978513398 4:109546245-109546267 ATCCTTCAGAATTCAGCCTAGGG + Intergenic
983055346 4:163094393-163094415 ATTCTTGAGCACACAGGCTAAGG - Intergenic
986178361 5:5371076-5371098 ATTCTTTACCATGAAGGCTACGG + Intergenic
986235425 5:5905264-5905286 ATCCTATACCAGTCAGGATAGGG + Intergenic
986610887 5:9565852-9565874 AATTTTTAGCAATCAGGCTAGGG + Intergenic
986635136 5:9813648-9813670 ATCAGTTAGAATACAGGCTAAGG - Intergenic
997288034 5:132698036-132698058 ATTCTTTAGCATTTAGGTGAGGG - Intronic
998379362 5:141713082-141713104 ATCCTTTAGAATTCAGCCCAAGG + Intergenic
1000788355 5:165573650-165573672 TTCCTGGAGCATTCAGACTAAGG + Intergenic
1004058599 6:12167191-12167213 ATCATTTAAAATTCAGGCCAGGG - Intergenic
1010514470 6:76756209-76756231 ATCCTTTTGTTTTCAGTCTATGG - Intergenic
1010876261 6:81110590-81110612 ATCCTTGACCTTTCAGGCTCAGG + Intergenic
1012423126 6:99085958-99085980 CTCCTTTAAAATTTAGGCTATGG - Intergenic
1013040588 6:106429453-106429475 ATCCTTTTGCATTTAAACTATGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014141815 6:117952386-117952408 ATCCTTTAGCATTCAGGCTATGG - Intronic
1014619096 6:123643490-123643512 ATCCTTTTGCATTCAGAATGAGG + Intergenic
1014801917 6:125788016-125788038 ATCTTTAAGAATTCAGGCTCTGG - Intronic
1025803294 7:64808061-64808083 ATCCTTAAGCAATCAGCCTAGGG + Intronic
1026663198 7:72320291-72320313 ATCCAGTACCATTCAGGCAAGGG + Intronic
1027618461 7:80452812-80452834 GTTCTTTGGCATTCAGGATAGGG + Intronic
1028634824 7:92976153-92976175 TACCTTTAGCATTCAGGCAGAGG - Intergenic
1030427956 7:109404225-109404247 ATCATATAGCATCCATGCTAGGG - Intergenic
1031930804 7:127683915-127683937 AGCCTTTAGCATTCAGGGAGAGG + Intronic
1031936378 7:127739493-127739515 ATCCTTGAGGATGCAGGCCAGGG - Intronic
1033541431 7:142359341-142359363 ATCCATTGGCATCCAGGCCAAGG - Intergenic
1034538682 7:151742214-151742236 GTCCTATGGGATTCAGGCTAGGG - Intronic
1048184797 8:132229834-132229856 ATCCTAATGCATTCAGCCTAGGG - Intronic
1049958830 9:718756-718778 ATGTATTAGCATTCAGGCTGAGG + Intronic
1051902294 9:22056653-22056675 AACATGTAGCATTCAGGCCAAGG - Intergenic
1053780871 9:41606031-41606053 ATCCTTTGAAATTCAGGCTGAGG - Intergenic
1054168814 9:61816188-61816210 ATCCTTTGAAATTCAGGCTGAGG - Intergenic
1054668717 9:67764623-67764645 ATCCTTTGAAATTCAGGCTGAGG + Intergenic
1057225386 9:93290186-93290208 ATCCTTTAGCATCCAGTGTAGGG + Intronic
1058557019 9:106180080-106180102 AGCCTTCAGTAGTCAGGCTAAGG + Intergenic
1059192405 9:112339087-112339109 ATCCTTTAAGATTTAGGCAAGGG + Intergenic
1186493351 X:9992507-9992529 ATCCTTTGGCATTCACGCCCCGG - Intergenic
1188693800 X:33162685-33162707 AGCCTTTAGCTTTTGGGCTATGG - Intronic
1189239320 X:39513561-39513583 AACCATTAGCCTACAGGCTAAGG + Intergenic
1191150688 X:57218941-57218963 CTCCTTAAGCTTTCAGGCCATGG - Intergenic
1193357960 X:80544250-80544272 ATCCCTTTGCCTTCAGCCTATGG - Intergenic
1193912286 X:87320371-87320393 ATCCTGAAGCATGCATGCTAAGG - Intergenic
1196043386 X:111230398-111230420 AACCTTTATCATTCAGGATTTGG - Intergenic
1196045663 X:111253803-111253825 TTCCTTTAGCATTCAGGTAGAGG - Intronic
1197863565 X:130995484-130995506 ACCCTTATGCATTCAGGCCAAGG + Intergenic
1202172668 Y:22067320-22067342 ATTGTTTAGCATTTAGGTTAGGG - Intergenic
1202218694 Y:22519051-22519073 ATTGTTTAGCATTTAGGTTAGGG + Intergenic
1202324492 Y:23677004-23677026 ATTGTTTAGCATTTAGGTTAGGG - Intergenic
1202546279 Y:25993050-25993072 ATTGTTTAGCATTTAGGTTAGGG + Intergenic