ID: 1014147271

View in Genome Browser
Species Human (GRCh38)
Location 6:118012501-118012523
Sequence TTGGGTCCACACACCAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014147271 Original CRISPR TTGGGTCCACACACCAAGCA TGG (reversed) Intronic
900525072 1:3124608-3124630 GTGGCTCCACACACCAGGCCTGG - Intronic
900777344 1:4594791-4594813 TTGGGTCCCTACTCCATGCAAGG - Intergenic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906101928 1:43269567-43269589 TGGGGACCACACATCTAGCAGGG + Intronic
907160016 1:52362768-52362790 TAGGAACCACACAACAAGCAGGG + Intronic
907856867 1:58312157-58312179 TTAGAGCCACACACCGAGCAGGG - Intronic
909067610 1:70954286-70954308 TTGGGTCCACTAACCTAGGAAGG + Intronic
911209533 1:95124888-95124910 CTTGGTCCACACAACAAGGATGG + Intronic
912244436 1:107946031-107946053 CAGGGTCCATACTCCAAGCATGG + Intronic
916335701 1:163668951-163668973 TTTGGTCCAAACACCAACCAGGG + Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
923600664 1:235399883-235399905 TTTTCCCCACACACCAAGCAGGG - Intronic
1066024672 10:31343009-31343031 TTGGGTACACATTCCAAGGACGG + Intronic
1069681867 10:70291308-70291330 TTGTGTGCACACACCAAGGAAGG - Intergenic
1070761636 10:79027774-79027796 TGTGGTCCACACACCCACCACGG + Intergenic
1072211259 10:93248949-93248971 TCAGGTCCACCCACCCAGCAGGG - Intergenic
1075640155 10:124058872-124058894 TTGTGTCCAGACACCAGGCTGGG + Intronic
1077341921 11:2030057-2030079 TTGGCTCAACACAGCAAGGAGGG + Intergenic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1079489422 11:20971018-20971040 TTGGGGACAGACACAAAGCAAGG - Intronic
1081390663 11:42524959-42524981 GTAGGTCCAAACACCAAGGAAGG - Intergenic
1084586635 11:70066324-70066346 TGGGCCCCAAACACCAAGCATGG - Intergenic
1087602140 11:100329693-100329715 CTGGGTCCAGCCACCCAGCAGGG - Intronic
1088476868 11:110249730-110249752 ATGGGTACACACACCATGCCCGG - Intronic
1088603056 11:111500423-111500445 TTGGCTCCACACAGAAAGGAAGG - Intronic
1202824907 11_KI270721v1_random:85246-85268 TTGGCTCAACACAGCAAGGAGGG + Intergenic
1099199775 12:79661800-79661822 CTGGGGCCATACACTAAGCAGGG + Intronic
1102729495 12:115095857-115095879 TTGAGTCCACACAGCTAGTAAGG + Intergenic
1103153644 12:118664017-118664039 TTGGCTCCACACCCCATGAAAGG + Intergenic
1104313087 12:127671792-127671814 CTGGGCCCGCCCACCAAGCATGG + Intergenic
1104508977 12:129358746-129358768 TGGGGTTCACATCCCAAGCATGG - Intronic
1107720582 13:43244219-43244241 TTTGGTCCTCACAGCAACCATGG - Intronic
1108522380 13:51258078-51258100 GTGCTTCCACACACCAAGGAAGG - Intronic
1109256477 13:60089262-60089284 TTGAGTGGACAAACCAAGCATGG - Intronic
1113743619 13:112727638-112727660 GAGGCTCCACACACCATGCAGGG + Intronic
1117070779 14:52053905-52053927 TTGGATCCTCACACCAAAGAAGG - Exonic
1117354021 14:54906248-54906270 TTTCTCCCACACACCAAGCAGGG - Intergenic
1117508571 14:56426360-56426382 TTGGGTCCAAACAAGAAGAACGG + Intergenic
1120493246 14:85203293-85203315 TTGGGGCCACATGCCAACCAAGG - Intergenic
1121236872 14:92398116-92398138 TTAGGTCCACACACCAAAAGAGG + Intronic
1122170693 14:99872163-99872185 TCGGGGCCAAACACCAAGTAAGG + Intronic
1122277703 14:100603723-100603745 CTGGGCCCACACACCTTGCAAGG + Intergenic
1122641614 14:103163374-103163396 TTCTGTCCAAACACCAAGGACGG - Intergenic
1123798419 15:23797228-23797250 TTGGATCCAGAAGCCAAGCAAGG - Intergenic
1126270659 15:46813564-46813586 TTGGGACCACACACCAGTCCTGG - Intergenic
1127873486 15:63092425-63092447 CTGGGCTCACACACCAGGCAGGG - Intergenic
1131178361 15:90224032-90224054 GTGGGTCCCCACACCATGCTGGG + Intronic
1132248741 15:100317605-100317627 CTGGGGCCACACACCTCGCATGG - Intronic
1132981617 16:2741153-2741175 CTGGGTTCACACAACAAGCTCGG - Intergenic
1133226909 16:4345256-4345278 CTGAGTCCACACACCAGGCACGG + Intronic
1133519908 16:6546887-6546909 TGTGGTCCACAAACCAAGCATGG - Intronic
1134356176 16:13484144-13484166 TTTCCTCCACACGCCAAGCAGGG - Intergenic
1135086503 16:19478828-19478850 TTGGGTGCACAGCCCAAGGATGG - Intronic
1135117317 16:19734829-19734851 CTGCTTCCACACACAAAGCAGGG - Intronic
1135259599 16:20969635-20969657 TTGGGTGCACACACACAGCCTGG + Intronic
1136398168 16:30004309-30004331 TTGTGCCCACAGACAAAGCACGG + Intronic
1137794245 16:51201759-51201781 TCTAGTCCAAACACCAAGCAAGG + Intergenic
1138627934 16:58267159-58267181 TTGGGTCCAGTCACCATGTAGGG - Intronic
1141802953 16:86323449-86323471 TTGGATCCACACGCCCAGCGGGG - Intergenic
1148602755 17:48906950-48906972 TTGGAATGACACACCAAGCAAGG - Intergenic
1149453242 17:56766495-56766517 TTGGGTCCAGAAAACCAGCAGGG + Intergenic
1149536505 17:57437728-57437750 TTTGGTCCACACAGAATGCAGGG - Intronic
1152058449 17:78050727-78050749 TTGCGGCCCCACTCCAAGCATGG - Exonic
1155245895 18:23908703-23908725 GTGGGTTCACACACCCAGTAGGG - Intronic
1156020992 18:32598674-32598696 GTGGGTCTAGCCACCAAGCAAGG - Intergenic
1158266712 18:55666978-55667000 TTTGTTCCACACACTCAGCATGG - Intergenic
1158389843 18:57035931-57035953 TTGGGTTTACAAACCAGGCAAGG - Exonic
1159017701 18:63115076-63115098 TTTTCCCCACACACCAAGCAGGG - Intergenic
1160463153 18:79054731-79054753 TTGGGTCACCCCACCAGGCAAGG - Intergenic
1167528484 19:50000394-50000416 TTTGGACCCCACACCCAGCACGG + Intronic
926341712 2:11909573-11909595 TTGGGTCCTCAGACCAACCCTGG + Intergenic
929189889 2:39130101-39130123 CTGGGTCAACAGACCAAGAAGGG + Intergenic
930603484 2:53468800-53468822 CTGTGTGCACACACCAAGGAAGG - Intergenic
935376906 2:102409120-102409142 TTGGGTGCACCCCCCAAACAGGG + Intergenic
936541933 2:113359299-113359321 TTTGGTCCACATAACAAGTAAGG + Intergenic
940387431 2:153090224-153090246 TTGGGTCTAACCACCCAGCAGGG + Intergenic
941884390 2:170513395-170513417 ATGGGTCTACAAACCAAGGAAGG - Intronic
945338191 2:208617837-208617859 CTGGGTCTAGACACCCAGCAGGG + Intronic
946143827 2:217713852-217713874 TTCGGGCCAGACACCAAGAAAGG - Intronic
946543467 2:220711310-220711332 TAGGGCCCACAAACCAAGGAAGG + Intergenic
1170731764 20:18982345-18982367 GTGTGTCCACTCACCAAGGAAGG - Intergenic
1176177153 20:63734125-63734147 TTGTGTCCAGACAGCCAGCATGG + Intronic
1176416062 21:6475399-6475421 TTGGGCCCACACAGCATGCAGGG - Intergenic
1179314054 21:40225544-40225566 TTGAGTCCACACACAAAGAAGGG - Intronic
1179691562 21:43083733-43083755 TTGGGCCCACACAGCATGCAGGG - Intergenic
1183288512 22:36982992-36983014 TGAGGTCCACAGTCCAAGCAGGG - Intergenic
1185081338 22:48710975-48710997 TTGGGGTCTCACACCAAGCCAGG - Intronic
959477427 3:106827927-106827949 TTTGCTCCACACACCTAGAAAGG + Intergenic
961457455 3:127031270-127031292 TGGGGGCCACACACACAGCAGGG - Intronic
980186978 4:129474877-129474899 TCGGGTCCAGCCACCCAGCAGGG + Intergenic
986548766 5:8929153-8929175 TTGGAGCCAAAAACCAAGCAAGG + Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
990555056 5:56924699-56924721 TTGGCTCCACACCCAAACCAGGG + Intronic
993398391 5:87418993-87419015 TACGGTCCACAAGCCAAGCATGG + Intergenic
993613790 5:90085303-90085325 TTGGGTCTAGCCACCCAGCAGGG - Intergenic
995956715 5:117785277-117785299 TTTGGTCAACACATCAAGCATGG + Intergenic
996944194 5:129047133-129047155 TTGAGTCAACAGACCAAGAAGGG - Intergenic
1000574358 5:162958324-162958346 TTGGGACCATTCAGCAAGCATGG + Intergenic
1001516166 5:172356646-172356668 CTGGGTCCAAACACCAAACGGGG + Intronic
1007528067 6:42514228-42514250 TTCTATCCACACAGCAAGCAAGG - Intergenic
1009360914 6:62812006-62812028 TTGGGCCTATACACAAAGCAAGG - Intergenic
1014147271 6:118012501-118012523 TTGGGTCCACACACCAAGCATGG - Intronic
1018913470 6:168117726-168117748 CTGGGACCACAGACCATGCAGGG + Intergenic
1019476034 7:1244763-1244785 ATGGGACCAGACACCACGCACGG + Intergenic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1023605037 7:41922513-41922535 TTGTGACCATACACCAAGAAAGG + Intergenic
1023931154 7:44707459-44707481 TGAGGGCCACACCCCAAGCAAGG - Intronic
1024008049 7:45241732-45241754 TGGGGTCCACACATTAAGGATGG + Intergenic
1026592760 7:71711053-71711075 TTGGGTCCACAAGCCCAGCCCGG - Intronic
1028988566 7:97026299-97026321 GTGGCTCCACACTCCAAGTAAGG - Intergenic
1033405687 7:141070697-141070719 TTGGGTTCCCACTGCAAGCAGGG + Intergenic
1036958134 8:13213679-13213701 TTGGGTCCATACAGCAGACATGG - Intronic
1037884514 8:22589233-22589255 TTGGGCCAACACACCCAGGAGGG - Intronic
1042738256 8:72012853-72012875 TTTGGTCCACAAAGCAATCAAGG - Intronic
1056224724 9:84483645-84483667 TTGTGTCCTCAGACCATGCAGGG + Intergenic
1058459125 9:105166441-105166463 TTGTGTGCACACACCACACATGG - Intergenic
1062141005 9:134959178-134959200 TTGGGTCACCCCACCAAACAAGG - Intergenic
1185686010 X:1928966-1928988 TTGAGACCAGACACGAAGCACGG - Intergenic
1187745932 X:22409355-22409377 TTGGGTCCTCACACCACAGATGG + Intergenic
1189663304 X:43326730-43326752 TTGGGTCTAGCCACCCAGCAGGG + Intergenic
1192905166 X:75543779-75543801 CTGGGTCTAAACACCCAGCAGGG + Intergenic
1193556586 X:82961192-82961214 CTGGGTCTAGCCACCAAGCAGGG - Intergenic
1195847296 X:109241959-109241981 TTCTGTGCACAGACCAAGCAAGG - Intergenic
1201017895 Y:9624073-9624095 TGGGGCCCAGACACCCAGCAGGG - Intergenic
1201059831 Y:10036078-10036100 TGGGGTCCAGATACCGAGCACGG - Intergenic