ID: 1014148889

View in Genome Browser
Species Human (GRCh38)
Location 6:118030510-118030532
Sequence AAGTAGAGCATACTACAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014148889 Original CRISPR AAGTAGAGCATACTACAGAT TGG Intronic
900921344 1:5672929-5672951 AAGGAGAACAAACTACAGATGGG - Intergenic
901749049 1:11394708-11394730 AAGGAGAGACTACTATAGATGGG - Intergenic
902454807 1:16525127-16525149 TAGTAGAGTAGACCACAGATGGG - Intergenic
909535411 1:76730309-76730331 AAGGAGAGCATGCTAAATATTGG + Intergenic
912061005 1:105670144-105670166 ATGTAGAGCCTACTACACTTGGG - Intergenic
914223980 1:145705216-145705238 AAGTAGCTAATACTACAGACAGG + Intronic
915253868 1:154610492-154610514 ATGCAGAGCATACTATAGTTTGG - Intronic
919552373 1:199006991-199007013 AAGTAAAGCAACTTACAGATAGG - Intergenic
924224950 1:241913859-241913881 AAGTAGATCATTCTAAGGATAGG + Intergenic
1063169247 10:3491850-3491872 GAGTAGAGAAAACTACTGATTGG + Intergenic
1065195366 10:23259170-23259192 AATTAGAGCTCACTAAAGATTGG - Intergenic
1067005309 10:42655260-42655282 AACAAGAGCATACTGCAGACAGG + Intergenic
1071585492 10:86816520-86816542 AAGAGGAGTACACTACAGATGGG + Intronic
1077736070 11:4792594-4792616 AAGTAGTGCATTCTACTGAGGGG - Intronic
1079017748 11:16883837-16883859 AAGTACTGCATGCTACAGAAGGG + Intronic
1080344879 11:31313133-31313155 AAAAAGAGCATAGAACAGATAGG - Intronic
1081007206 11:37759849-37759871 AAGTACCTCATACTACAGGTGGG + Intergenic
1088514788 11:110620157-110620179 AAGTAGCTAAGACTACAGATGGG + Intronic
1089669917 11:120047859-120047881 AAGAAGAGAATAATGCAGATAGG + Intergenic
1095430595 12:42130058-42130080 AGGTAGACTATACTATAGATTGG + Intronic
1096061463 12:48704067-48704089 AAGTAGAGAATCCATCAGATGGG + Intronic
1099162872 12:79266768-79266790 AAACAGAGCAAACTACAGATTGG + Intronic
1101239755 12:102825944-102825966 AAATAGATCATGCTACAGACAGG - Intergenic
1102144645 12:110645674-110645696 AAGTTGACAATCCTACAGATAGG + Intronic
1108927207 13:55768093-55768115 AAGTAAAGCAAAATACAAATTGG + Intergenic
1109016329 13:57020093-57020115 AAGTACAGCATACTTGATATGGG - Intergenic
1111228167 13:85303650-85303672 AAGTAGAGAATAATACAGAAAGG - Intergenic
1114540959 14:23457913-23457935 ACGTAGAGCAAAGTCCAGATAGG - Intergenic
1115178627 14:30595643-30595665 GATTAGAGCATACTAAGGATGGG + Intronic
1118984161 14:70739255-70739277 AAGTAGCTCGGACTACAGATGGG + Intronic
1127066270 15:55242778-55242800 AATTAGAGCATTCAACTGATGGG - Intronic
1127534863 15:59880705-59880727 AAGGAAAGCATACTAAGGATAGG + Intergenic
1127932147 15:63604040-63604062 AAATAGAACATACTAGAAATTGG - Intergenic
1134334967 16:13290149-13290171 GATTAGATCATACTACAAATGGG - Intergenic
1134739594 16:16530844-16530866 AAACAGAGTATCCTACAGATTGG - Intergenic
1134927905 16:18181308-18181330 AAACAGAGTATCCTACAGATTGG + Intergenic
1135261561 16:20985300-20985322 AAGAAGATCATACTGCAGGTCGG - Exonic
1138727473 16:59155873-59155895 AAGAAGAGGAGACTAAAGATGGG + Intergenic
1155055657 18:22180500-22180522 AAGTTGAGAATAATACTGATAGG + Intronic
1159169536 18:64747439-64747461 AAGTAGATCATTCTCCAGTTTGG + Intergenic
1160278274 18:77460506-77460528 AAGTACAGCATACAACAAATTGG - Intergenic
1166847933 19:45741401-45741423 AAGACAAGTATACTACAGATGGG + Intronic
1167167007 19:47805111-47805133 AAGCAGAGCTTAGTACACATTGG + Intronic
929652715 2:43697635-43697657 AAGTACAGCATCTTGCAGATGGG - Intronic
938886633 2:135656420-135656442 AAGTAGAATAAAATACAGATAGG - Intronic
942040950 2:172062313-172062335 AAGTATAACATACTAAATATGGG - Intronic
942832608 2:180254458-180254480 AAGTAGAGCAGACTTAAGCTTGG - Intergenic
944580455 2:201127603-201127625 AAGGAGAGCATACTAGGGAGAGG - Intronic
1169438931 20:5617972-5617994 AGGTAGTGCATACTATAGTTTGG - Intergenic
1171815386 20:29781828-29781850 AAGGAGAACGAACTACAGATGGG + Intergenic
1174115124 20:48221567-48221589 TATTACAGAATACTACAGATTGG + Intergenic
1174479422 20:50820409-50820431 AAATAGAGAATTCAACAGATGGG + Intronic
1180318833 22:11302395-11302417 AAGGAGAACGAACTACAGATGGG + Intergenic
1181262634 22:21609578-21609600 AAGTAGCTGAGACTACAGATAGG - Intronic
1181743357 22:24938956-24938978 CAGTAGAGCATCCTAAAGAAGGG + Intronic
1182308104 22:29385256-29385278 AAGTAGCTAGTACTACAGATGGG - Intronic
1183145709 22:35989694-35989716 AAGTAGAACTCACTACAGAAAGG + Intronic
1184982792 22:48106178-48106200 AAGTAGGGCAGACTCCACATGGG - Intergenic
950825387 3:15813528-15813550 AAGTACAGCATACTGCACCTTGG + Intronic
951342013 3:21499845-21499867 AAGTAAAGCAAACTAGAGACTGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953772621 3:45790618-45790640 AAGGAGAGCAGAGAACAGATGGG - Intronic
954978279 3:54718175-54718197 AAGAAGAGCAAACTACAGGGTGG - Intronic
956917634 3:73889692-73889714 AAGTAGAACATGCTAACGATAGG + Intergenic
958800080 3:98744946-98744968 ATGCAGAGCATACTAGACATGGG + Intronic
963279813 3:143372662-143372684 CAATAGAGCAAACTACAGAATGG + Intronic
963380211 3:144520536-144520558 AAGTAGAGCATGAGACAGGTGGG + Intergenic
965777382 3:172246016-172246038 AAGTAGTGCTTAAGACAGATTGG - Intronic
966070373 3:175870323-175870345 CAGTAAACCATACTACATATAGG - Intergenic
971234775 4:24830858-24830880 AAGTAGCAAATACTACACATGGG - Intronic
975965302 4:79966236-79966258 AAGTAGAGGATACTACCACTTGG + Intronic
977025660 4:91815982-91816004 AATTATAGCATACTAAAGAAAGG + Intergenic
978045812 4:104125782-104125804 AAGTAGAGCAGAATTGAGATTGG + Intergenic
980515666 4:133855995-133856017 AAGTACTGCATACTCCAGAAAGG - Intergenic
980828711 4:138103761-138103783 AAGTAGAGCAAAGTTCAGAGAGG + Intergenic
982071793 4:151701925-151701947 TGGTACAGCCTACTACAGATAGG + Intronic
982742706 4:159074415-159074437 AAGTAGAGCCTTCTATAGAATGG - Intergenic
983084849 4:163430132-163430154 AAGTAGGGCCTACTTCAGATAGG + Intergenic
983424798 4:167569609-167569631 AAGTAGAGCAGGTTTCAGATGGG - Intergenic
983972529 4:173892554-173892576 AAGCAGTGCATGGTACAGATAGG + Intergenic
984289236 4:177772197-177772219 AAGCAGAGCATTATACACATTGG - Intronic
984477661 4:180257786-180257808 AAGATGAGAATACTACAGAGTGG - Intergenic
986814108 5:11389713-11389735 AAGAAGAGCCTACTACAGTCTGG + Intronic
987686985 5:21217570-21217592 AAGAAAAGCAAACAACAGATAGG + Intergenic
987692495 5:21284505-21284527 AAGTAGAGAAAAGTAGAGATAGG - Intergenic
989278834 5:39619214-39619236 AAGTATAAAATACTACATATTGG - Intergenic
990483527 5:56235272-56235294 AAGTAGAGGATACTGTAAATTGG + Intergenic
991703151 5:69334024-69334046 CAGAAGAGCCAACTACAGATGGG - Intergenic
991747860 5:69765548-69765570 AAGTAGAGAAAAGTAGAGATAGG + Intergenic
991749869 5:69789775-69789797 AAGTAGAGAAAAGTAGAGATAGG - Intergenic
991799438 5:70345406-70345428 AAGTAGAGAAAAGTAGAGATAGG + Intergenic
991801443 5:70369583-70369605 AAGTAGAGAAAAGTAGAGATAGG - Intergenic
991827154 5:70640437-70640459 AAGTAGAGAAAAGTAGAGATAGG + Intergenic
991829159 5:70664632-70664654 AAGTAGAGAAAAGTAGAGATAGG - Intergenic
991891796 5:71344825-71344847 AAGTAGAGAAAAGTAGAGATAGG + Intergenic
995652609 5:114386935-114386957 AAGTACAGCATCCTAAAGGTAGG - Intronic
998363468 5:141611769-141611791 AATTAAAGCATACTGCAGCTGGG + Intronic
1001384823 5:171330061-171330083 GAGAAGAGCATACTTCAGAGAGG - Intergenic
1004728986 6:18339341-18339363 AAGTAGATAACACTAAAGATGGG + Intergenic
1011618785 6:89222607-89222629 AAAAAGAGCACATTACAGATGGG - Intronic
1012373519 6:98533750-98533772 CAGTAGAGCATATTACTGAGAGG + Intergenic
1012433845 6:99193725-99193747 AAGTGGGGCAGACTGCAGATAGG + Intergenic
1014148889 6:118030510-118030532 AAGTAGAGCATACTACAGATTGG + Intronic
1014476714 6:121882274-121882296 CAATAGTGAATACTACAGATGGG - Intergenic
1016208104 6:141495026-141495048 AAGTAAAGAATAATACAGAAAGG - Intergenic
1016593430 6:145771506-145771528 AAGAACAGAAAACTACAGATCGG - Intergenic
1020388781 7:7636026-7636048 AAGTAGCTCAGACTACAGGTGGG - Intergenic
1020903958 7:14041610-14041632 AAGTAGAGCAGAATACAGGATGG - Intergenic
1021657700 7:22888465-22888487 AAGTAGAGCTTATTAAAGTTAGG + Intergenic
1022587313 7:31626489-31626511 AAGGGAAGCATACTACAGAAAGG - Intronic
1023525373 7:41097092-41097114 AAGTACAGCATCCTCCTGATGGG + Intergenic
1028061038 7:86316315-86316337 AAGTAGAGAAAACTGCAAATTGG + Intergenic
1030471369 7:109966654-109966676 AAGCAGAGCCTACTACCGCTGGG + Intergenic
1030695948 7:112585710-112585732 AAGTAAAGCATACTACAAGCGGG - Intergenic
1036391820 8:8330423-8330445 AAGGATTGCTTACTACAGATGGG - Intronic
1041108404 8:54463474-54463496 AACTTGAGCCTACTCCAGATGGG - Intergenic
1041206531 8:55504508-55504530 AAGTAAAGAAAACTACAGCTGGG - Intronic
1041845475 8:62322727-62322749 AATTGGATCATGCTACAGATGGG + Intronic
1045812088 8:106233684-106233706 AAGTATTGTATACTACAGCTAGG + Intergenic
1047090085 8:121564930-121564952 CAAAAGAGCAAACTACAGATTGG + Intergenic
1047116607 8:121849149-121849171 AAGAAGAGCAAACTACTCATGGG + Intergenic
1058280755 9:103110707-103110729 AAGTAGAGCATGCTTAACATAGG + Intergenic
1060492485 9:124095093-124095115 AAGTAGAACATTCTTCAGAAAGG + Intergenic
1062490132 9:136800983-136801005 AAGCAGAACCTACTCCAGATGGG + Intronic
1203367053 Un_KI270442v1:268146-268168 AAGGAGAACGAACTACAGATGGG + Intergenic
1189463730 X:41262602-41262624 AAGTTGATCATACTTCAGCTGGG - Intergenic
1189487724 X:41445906-41445928 AAGAAGAGAATACTAGGGATGGG - Intergenic
1189550368 X:42086432-42086454 AAGGAGAGCATTCTAAAGAGGGG - Intergenic
1190341637 X:49301262-49301284 ATGTAAAGCATACTACAGTTTGG - Intronic
1191959078 X:66679739-66679761 AAGAAGAAAAGACTACAGATGGG + Intergenic
1192397267 X:70794826-70794848 AAGTAGTGCATACCATAGATGGG + Intronic
1195424316 X:104711209-104711231 GATTATAGCCTACTACAGATAGG - Intronic
1195533680 X:105986109-105986131 AAGTAGAGCATCCTATGGAGAGG + Intergenic
1199428449 X:147730988-147731010 ACTTAGAGAATGCTACAGATTGG + Intergenic
1199775166 X:151004467-151004489 AAGGAGAGAATACTACATAAAGG + Intergenic