ID: 1014149920

View in Genome Browser
Species Human (GRCh38)
Location 6:118042849-118042871
Sequence GCTTTTGGAAGGGCTGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014149909_1014149920 23 Left 1014149909 6:118042803-118042825 CCAGTATTGGTGACCAATTGAAT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 229
1014149911_1014149920 10 Left 1014149911 6:118042816-118042838 CCAATTGAATGTGGAACATATGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014149920 Original CRISPR GCTTTTGGAAGGGCTGGCTT GGG Intronic
900382934 1:2394078-2394100 GCTTTCAGATGGCCTGGCTTTGG + Intronic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
900935941 1:5766429-5766451 GCTTGTGGGAGGGCTGCCCTGGG - Intergenic
902647340 1:17809368-17809390 GTTTTTGGAAGGGCTAGCCGGGG + Intronic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904363175 1:29991651-29991673 GCTTGTGGAGGGCCTGGCATGGG + Intergenic
904494185 1:30877549-30877571 GCTTGTGGTAGGGGTGCCTTTGG - Intronic
904702380 1:32365665-32365687 GCTTCTGGAAGGGCTATCCTGGG - Intronic
905126204 1:35717933-35717955 GGTTCTGGAAGAGCTGGGTTTGG + Intronic
906575818 1:46888487-46888509 GCTTTGGGAAGGGATGGCCCTGG - Intergenic
906596155 1:47079407-47079429 GCTTTGGGAAGGGATGGCCCTGG + Intronic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
907350860 1:53829693-53829715 GCTTTAAGAAGGACTGGCTGGGG + Intronic
908339238 1:63159430-63159452 GCCTTTGGAGGGGCTGGGGTGGG + Intergenic
908471743 1:64450973-64450995 ACATTTGGAAGGGCTGGCTAAGG + Intergenic
909347082 1:74603111-74603133 ACCTGTGGAAGGGCTGGCTTCGG - Intronic
910292978 1:85616628-85616650 GCTTCCGGACGGGCTAGCTTGGG + Intergenic
911342749 1:96658803-96658825 GCTACTGGAAGGGCTGAGTTGGG - Intergenic
912430144 1:109624577-109624599 CCTTTTGGAGGGGCAGGCTAAGG + Intronic
912707649 1:111926864-111926886 GCTTTAGGAAGTGCTCCCTTTGG + Intronic
913330110 1:117660005-117660027 GCTTTGGAAGGGGCTGGCTGAGG - Intergenic
917076430 1:171210606-171210628 TCTCTTGGAAGGGCTTGGTTTGG - Exonic
917156511 1:172005587-172005609 GCTTTTTGAAAGGGTGGCTCTGG - Intronic
919934398 1:202241968-202241990 TGTTTTGGATTGGCTGGCTTGGG - Intronic
920259606 1:204679938-204679960 GGCTTGGGCAGGGCTGGCTTAGG + Intronic
920580094 1:207098369-207098391 GCTTTTGAATGGGTTGGCCTTGG + Intronic
920849185 1:209617212-209617234 GCTTTTGGTATAGCTGGCTCAGG - Intronic
921215881 1:212936438-212936460 GCTTTTGGAGGCGTTGGGTTGGG - Intergenic
921314491 1:213877479-213877501 GCTTTGGGAAAGGGTGGGTTTGG - Intergenic
923555408 1:234997082-234997104 GCTTTAGGAAGGGCTGTGTCAGG + Intergenic
1064342858 10:14502069-14502091 GATTTTGCACGGGATGGCTTTGG - Intergenic
1064627816 10:17279399-17279421 TCCTTTGGAAGAACTGGCTTTGG - Intergenic
1064639442 10:17400550-17400572 GCTTTTTGATGTGCTGGATTTGG - Intronic
1065599548 10:27354841-27354863 GCTTCCGGAAGAGCAGGCTTCGG + Intergenic
1069196220 10:65554870-65554892 GCTTTTGGAAAGGGAAGCTTAGG - Intergenic
1069313815 10:67072873-67072895 CCTTTTGGAAGCTCTGCCTTTGG + Intronic
1070264716 10:74891245-74891267 GCTACTGCAAGGGCTGCCTTTGG + Intronic
1072048868 10:91683799-91683821 GCTTTTGGAGGGGCTAGGATAGG - Intergenic
1072652742 10:97308251-97308273 GGTTTGAGAAGGGCAGGCTTTGG + Intergenic
1075551776 10:123397936-123397958 TCTTTGGCAAGGGCTGTCTTGGG - Intergenic
1075633253 10:124014005-124014027 GCTTTAAGCAGGGCTGGCTGTGG - Intronic
1076060241 10:127408302-127408324 CTTCTTGGAAGGGCTGGGTTTGG - Intronic
1077499381 11:2902340-2902362 GCCTTTGCAGGGGCGGGCTTGGG - Intronic
1082129563 11:48471511-48471533 GCTTGGGGAAGGGGTGACTTGGG + Intergenic
1082199002 11:49340255-49340277 GCTATTGGGAGGCCTGGCTGGGG + Intergenic
1082247529 11:49942180-49942202 GCTTGGGGAAGGGGTGACTTGGG - Intergenic
1082563092 11:54642403-54642425 GCTTGGGGAAGGGGTGACTTGGG + Intergenic
1082788043 11:57328084-57328106 GCTTCTGGAAGGTCTGAATTAGG - Intronic
1083597491 11:63925334-63925356 GCCTTGGGAAAGGCTGGCATTGG - Intergenic
1083690800 11:64407380-64407402 GCCTCTGGAAGGGCCGGCTCAGG + Intergenic
1085447718 11:76611688-76611710 GCTTTATGAAGGGGTGGCCTGGG + Intergenic
1085759923 11:79233089-79233111 GCTTCTAGAGGGGCTGGCATGGG - Intronic
1085901748 11:80708453-80708475 GCTTTTTGAATGGCAGGCTAAGG + Intergenic
1085901756 11:80708545-80708567 GCTTTTTGAATGGCAGGCTAAGG + Intergenic
1086656811 11:89367832-89367854 GCTATTGGGAGGCCTGGCTGGGG - Intronic
1087293005 11:96340297-96340319 GCTTTTGCTAGGGCTGACCTGGG + Intronic
1087956283 11:104291628-104291650 GAATTTGGAAAGGCTTGCTTGGG + Intergenic
1090700498 11:129290749-129290771 TGTTTTGGAATGTCTGGCTTAGG - Intergenic
1092106852 12:5927483-5927505 GATTTCGGAAGGACTGGTTTGGG - Intronic
1093167198 12:15817700-15817722 GATTTTGGAAAGGTTGGGTTGGG + Intronic
1096056921 12:48660988-48661010 TCTTTTGGAAGGGCTGTTTAGGG - Intronic
1096563233 12:52451909-52451931 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1096565385 12:52473568-52473590 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1096567405 12:52493019-52493041 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1098927081 12:76362302-76362324 GCTTTTTGATGTGCTGGATTCGG - Intronic
1099067916 12:78006868-78006890 GCTTTTGGAGGGGCCAACTTAGG - Exonic
1101068773 12:101050865-101050887 GCATTTGGAAGTTCTGCCTTGGG + Intronic
1101275941 12:103201339-103201361 GCTTTGTGAAGTGCTTGCTTTGG + Intergenic
1102588753 12:113941752-113941774 GCTGTTGAAAGGGCTGTTTTGGG + Intronic
1102626088 12:114236508-114236530 GAATCTGGAAGGGCTGTCTTGGG + Intergenic
1102701042 12:114839746-114839768 CTTTTTGGAAGGGCTGGTTTAGG + Intergenic
1107897887 13:44984184-44984206 GCTTTTGGAAGAAGTGTCTTAGG - Intronic
1108207162 13:48102024-48102046 GCTTTTGAAAGTGCAGGCTGAGG - Intergenic
1112827366 13:103407430-103407452 GCTTTCTGAAATGCTGGCTTTGG - Intergenic
1113531642 13:111031906-111031928 GCTCCTGGAAGGTCTGGCTTGGG + Intergenic
1114711168 14:24779814-24779836 GATGATGGTAGGGCTGGCTTAGG - Intergenic
1115701730 14:35960058-35960080 GTTTTTGGAGGGCATGGCTTAGG + Intergenic
1119901907 14:78268050-78268072 AGTTTGAGAAGGGCTGGCTTTGG - Intronic
1121437299 14:93928137-93928159 TCTTTTGGGAGGGCTGGGTGTGG + Intronic
1122036799 14:98954812-98954834 GCTCAGGGAAGGGCTTGCTTGGG - Intergenic
1122731375 14:103801220-103801242 GTTTTGGGAAGGGCTGGTGTTGG - Intronic
1123839583 15:24234473-24234495 GCTTCTGGGGAGGCTGGCTTGGG + Intergenic
1123906186 15:24923796-24923818 GTTTTGGGAAGGGCTCACTTGGG + Intronic
1124464083 15:29920551-29920573 GCGTTTGGAAGGGAAGGCTGAGG - Intronic
1125722862 15:41853467-41853489 GCTGTTGTCAGGGCTGGCTGGGG + Intronic
1126477430 15:49080096-49080118 GCTGTTGGAAGGGAAGGTTTGGG - Intergenic
1128707993 15:69851444-69851466 GCAGTTGGAGGGGCTGGGTTTGG - Intergenic
1129193501 15:73951308-73951330 GCTCTTGGAAGGAAGGGCTTTGG - Intronic
1131180306 15:90234474-90234496 ACTTCTGGAAGAGGTGGCTTGGG - Intronic
1131624382 15:94102013-94102035 ATTTTGGAAAGGGCTGGCTTAGG - Intergenic
1134278141 16:12794937-12794959 GCTTTTGGCATCACTGGCTTTGG + Intronic
1134628102 16:15737302-15737324 GCTTGTGGGAGGCCTGGCCTGGG + Intronic
1135597545 16:23755410-23755432 GCGGTTGGAAGGGATGGCTTTGG + Intronic
1136366993 16:29813508-29813530 TCTGGTTGAAGGGCTGGCTTGGG - Exonic
1137720275 16:50623540-50623562 GCTTCTGGAGGGGCAGACTTGGG + Intronic
1138520235 16:57566896-57566918 GTTTCTGGAAAGGCTGGGTTAGG + Intronic
1139599351 16:67977232-67977254 GCTTTGTGCAGTGCTGGCTTGGG - Intronic
1139903586 16:70347089-70347111 GCTTTTGGGAGGTTTCGCTTGGG - Intronic
1140190496 16:72811819-72811841 ACTTTTGGGTGGGCGGGCTTGGG - Intronic
1143032880 17:3977446-3977468 GCCTTTGGAAGTGCTGCTTTTGG - Intergenic
1146669615 17:34727786-34727808 GCCTTGGGAAGGGCATGCTTTGG + Intergenic
1147218576 17:38914981-38915003 GCTCTGGGAGGGGCTGGGTTTGG + Intronic
1150713155 17:67548623-67548645 GCTTTTGAAAAGTCTGTCTTTGG + Intronic
1151067600 17:71169549-71169571 ACTTTTGGAAGGGGTTGCTGTGG + Intergenic
1152600423 17:81259485-81259507 GCTCGTGGGAGGGCTGGCCTGGG + Intronic
1152664448 17:81559206-81559228 GCTTCAGGAAGGGCTGGGCTGGG + Exonic
1152905030 17:82965317-82965339 GCTTTTGGCAGAGCTGTCTCTGG - Intronic
1156522222 18:37731632-37731654 GCTTTTGGGAGGGATGCCATGGG - Intergenic
1158931146 18:62325665-62325687 GCTTTTGGAAGAGCCCGTTTCGG - Intronic
1160259302 18:77276319-77276341 GCTACTGGAAGTGCTGTCTTTGG + Exonic
1160520985 18:79507834-79507856 GCTTTCGGAGGAGCTGGCTGTGG + Intronic
1160749099 19:725664-725686 GCTTTTGCAAGCCCAGGCTTGGG + Intronic
1161092480 19:2368722-2368744 GTTTTTGGATGGACTGGGTTTGG + Intergenic
1161459899 19:4390341-4390363 GCCTTTTGCAGGGCTGGATTTGG - Intronic
1161526674 19:4760197-4760219 GCTGTTGGAAGGGGTGGGTTTGG + Intergenic
1163245884 19:16093829-16093851 GTTTGTGGAGGGGCTGGGTTGGG + Intronic
1164927784 19:32143761-32143783 GCTTGTGGAGATGCTGGCTTTGG - Intergenic
1165299557 19:34960234-34960256 GCTTATGGCAGGCCTGGCTCTGG - Exonic
1165691632 19:37868306-37868328 TCTTTTGAAAGGGCTGGTTTAGG + Intergenic
1167322746 19:48806561-48806583 GGTTCTGGAAGGGCTGGATTCGG + Exonic
1167549040 19:50146903-50146925 GCTTTTGGCAGGGATGCCCTAGG - Intergenic
1167557039 19:50203272-50203294 GCCTTTGTAAGGGCCGGCGTGGG - Intronic
927200855 2:20577312-20577334 TCTTTCTGAAGGGCTGGGTTTGG - Intronic
931459403 2:62437227-62437249 TCTTTTGATAGGGATGGCTTTGG + Intergenic
931815472 2:65896501-65896523 TCCTTAGGAAGGGCTGGCTCTGG + Intergenic
932113831 2:69026666-69026688 ACTTTTGGAAGTGCTGTTTTGGG + Intronic
932383364 2:71306694-71306716 GGCTTTGGAATGTCTGGCTTTGG + Intronic
932492115 2:72128791-72128813 GCTTTGAGAAGTGCTGGCATGGG + Intergenic
936984502 2:118296392-118296414 GATTTGGGAAGGGCAGGGTTTGG - Intergenic
937466146 2:122134815-122134837 GCCTTCTGAAGGGGTGGCTTTGG + Intergenic
938292248 2:130156405-130156427 GCTTTCCTGAGGGCTGGCTTTGG + Intronic
938951470 2:136258549-136258571 GTTTAAGGAAAGGCTGGCTTTGG + Intergenic
939512450 2:143123817-143123839 GCTTTTAGAGGAGCTGGCTTTGG - Intronic
940696023 2:156979526-156979548 GCTTTTCGAAGGGCTGCCTGAGG - Intergenic
943040723 2:182801887-182801909 GCTATTGGAAGGGCTGACCTTGG + Intergenic
943357947 2:186882363-186882385 GCTTTTGGAGGGGATGCCTGAGG - Intergenic
945768880 2:214015296-214015318 TCTTTTGAAAGGGCTGGTTTCGG + Intronic
946634252 2:221707048-221707070 GCTCCTGGAAGGGCTGGGTGGGG - Intergenic
947308736 2:228776965-228776987 GCTTGTGGAAGGGGTGGTTAGGG + Intergenic
947790067 2:232860912-232860934 GCTTTTGGTAGTGCTGGTTTTGG + Intronic
947939296 2:234035547-234035569 GCTTTAGGAAGCACAGGCTTTGG - Intergenic
1170983678 20:21238821-21238843 GCTCTTGGAAGGCCTGGCTGAGG + Intronic
1171116483 20:22529366-22529388 GCTTTAGGCAGGGCTGGGTAGGG - Intergenic
1173022827 20:39282560-39282582 ACTTTTAGAAGGGATGGCTGGGG - Intergenic
1175464981 20:59184812-59184834 GCTTTTGCAAAGGAGGGCTTGGG + Intergenic
1178315190 21:31561023-31561045 GGTTTTGGAAGGGGTGTCTTTGG - Intergenic
1180628305 22:17209329-17209351 GGTTTGGAAAGGGGTGGCTTGGG - Intronic
1182077176 22:27502811-27502833 GCGATTGGAAGGGCTGGAGTTGG - Intergenic
1183098901 22:35571234-35571256 GCCTTTGGAAGGTCTGGCTCCGG - Intergenic
1184413241 22:44337853-44337875 CCTTTTCAAAGGGCTGGCTGGGG + Intergenic
1185400023 22:50610856-50610878 GCTTTGGCAAGGACTGGATTGGG + Exonic
949977776 3:9476588-9476610 GCTTTTGGAATGGTTGTCTTAGG - Exonic
950633157 3:14297674-14297696 GATTTTGGGAGGGCTGGCGTTGG + Intergenic
950811708 3:15655547-15655569 GATTTTGAATGCGCTGGCTTGGG + Intergenic
950975468 3:17238220-17238242 GCTGTTGCAAGTGATGGCTTGGG + Exonic
952376698 3:32773560-32773582 GCATTTGGATGGGCTGGATCGGG - Exonic
953468532 3:43146701-43146723 TCTCTTGGAAGGGGAGGCTTAGG - Intergenic
953851429 3:46468203-46468225 GCTTTGGCATGGCCTGGCTTAGG - Intronic
953958893 3:47251973-47251995 GCTTGTGGAAGAGGTGGATTAGG + Intronic
954303831 3:49715188-49715210 GCTCTTGGAGGAGCTGGCCTTGG + Intronic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
963847100 3:150170659-150170681 CCTTTTGGAATGACTGACTTTGG + Intergenic
964763118 3:160153206-160153228 GCCTGTGGAAGGCCTGGCTGGGG - Intergenic
965252259 3:166356904-166356926 GCTTTTGGGAGTGCTCTCTTTGG + Intergenic
966656492 3:182364393-182364415 GCTGTTGGCAGGGCTGGCACTGG + Intergenic
968065017 3:195753761-195753783 ACGTTTGGAGGGGCTGGCGTGGG - Intronic
969819231 4:9707881-9707903 GCTTCTGGAAGGGCCCGCATGGG - Intergenic
969847366 4:9929953-9929975 GTCTTTGGGAGGGCTGGCTGAGG - Intronic
969966999 4:11007156-11007178 GCTTTTGAGAGGATTGGCTTTGG + Intergenic
970011384 4:11463423-11463445 GGTTTTGGGAGGAGTGGCTTGGG - Intergenic
970119062 4:12732287-12732309 GCATTTGGAAGGGGAGGCTGAGG + Intergenic
970852999 4:20624088-20624110 GCTTATGTAAGGGATGACTTAGG - Intergenic
974311980 4:60224260-60224282 GCTTTTGAAAAGCCTGGCTAAGG - Intergenic
974369719 4:60999701-60999723 GCTTTTTGAAGGGCTGTCCATGG + Intergenic
975622367 4:76307330-76307352 GCCTTTGGAAAGGGGGGCTTAGG + Intronic
976601059 4:86937758-86937780 TCTTTTGGTAGAGATGGCTTGGG + Intronic
977508680 4:97934730-97934752 GCTTTTTGATGTGCTGGTTTTGG + Intronic
977584564 4:98760595-98760617 GCTCTTGAAAGGGCTGGCTATGG - Intergenic
977830264 4:101582598-101582620 GCTGTTGGCAGGCCTGGCATGGG + Intronic
980776955 4:137449712-137449734 GCTTTTGGAAGGTTTACCTTAGG + Intergenic
984904962 4:184618099-184618121 TCTTTTGAAAGAGCTGGTTTTGG + Intergenic
990900549 5:60744345-60744367 TCTTCTGGAAGGGCTGACTGAGG - Intergenic
992491293 5:77247281-77247303 GCCTCTGAAAGGGCTGGCATTGG - Intronic
993916268 5:93745571-93745593 GCTTTTGGGAGGGATGCATTTGG - Intronic
997663416 5:135607105-135607127 GCCTTTGGAAGGGCAGCCATGGG - Intergenic
997921039 5:137979691-137979713 GCTTTTTATAGGGCTGGATTTGG - Intronic
998474440 5:142408691-142408713 GCCCTTGGAAGGGCAGGCCTGGG - Intergenic
998718150 5:144909653-144909675 AGTTTTGGAAGTGCTGGCTAGGG + Intergenic
999098043 5:148998785-148998807 GCTGCTGGAAGTGCTGGCTCTGG - Intronic
1000370896 5:160535644-160535666 GCTTTTAGCAAGGCTGCCTTTGG + Intergenic
1000533030 5:162447017-162447039 GTCTTTGGAAGGGATTGCTTTGG - Intergenic
1003563635 6:7204099-7204121 ATTTTTCTAAGGGCTGGCTTTGG + Intronic
1004619909 6:17323186-17323208 GCTTTTGGCAAGGCTGAATTTGG + Intergenic
1005010513 6:21331183-21331205 CCTTTTGTAAGGCCTCGCTTTGG - Intergenic
1010250985 6:73706819-73706841 CCTTTTGGCAGGGCTGTGTTAGG + Intronic
1010275657 6:73965909-73965931 GCTTCTGGAAAGGGTGACTTGGG + Intergenic
1010902605 6:81445905-81445927 CATCTTGGAAGAGCTGGCTTAGG - Intergenic
1011593557 6:88994600-88994622 GATTTTGGTTGGGATGGCTTTGG + Intergenic
1013012504 6:106133278-106133300 TCTATTGGAAGGGCTGGTCTAGG - Intergenic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1015512989 6:134058124-134058146 GGTCTTGGAAGGGCTGGTGTGGG - Intergenic
1017067653 6:150544389-150544411 GGTTTTGGAAGGGTTGCCTTAGG - Intergenic
1017989528 6:159473881-159473903 CCTTTTGGAAAGGCTGGGTAAGG - Intergenic
1018433928 6:163744477-163744499 GGTTTTGGGAGGTCCGGCTTAGG + Intergenic
1021377683 7:19928574-19928596 TCTGTTGGAAGGGAGGGCTTAGG - Intergenic
1023866563 7:44241219-44241241 GCTTTGGTCAGGGCTGGCTCCGG - Intronic
1024226234 7:47328483-47328505 GATTTTGGAGGGGCAGGTTTGGG - Intronic
1025105680 7:56170323-56170345 CCTTTTTGGAGAGCTGGCTTTGG + Intergenic
1025679602 7:63671517-63671539 ACAATGGGAAGGGCTGGCTTTGG + Intergenic
1029203593 7:98855268-98855290 TCTTTTGGAAGGTCTGAATTAGG + Exonic
1029632631 7:101762679-101762701 GATTTTGGAGGTGGTGGCTTGGG - Intergenic
1031553766 7:123146736-123146758 AATTTTGGAAGGCTTGGCTTTGG - Intronic
1031614464 7:123864683-123864705 ACTTTTGGAAGGGCAGGCTTGGG + Intronic
1033215024 7:139487212-139487234 GCTTTAGGAAGGGCTGAGATCGG - Intergenic
1034314537 7:150117627-150117649 CCTTTGGGAAGGGGTGGCTGTGG + Intergenic
1034588897 7:152121738-152121760 GCTTTAGGAAAGCCTGGGTTGGG + Exonic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036259352 8:7228054-7228076 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036307272 8:7611470-7611492 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036311395 8:7686624-7686646 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1036358116 8:8059457-8059479 GCTGCTGGAAGGGCTGGCCATGG - Intergenic
1036892833 8:12607489-12607511 GCTGCTGGAAGGGCTGGCCATGG + Intergenic
1037985690 8:23289218-23289240 GCCTTTGGAAGGGCAGGGCTGGG + Intronic
1038908760 8:31937854-31937876 TCTTTTGGCAGGGCTTGCTGTGG - Intronic
1041385142 8:57293299-57293321 GCTTTTTGATGTGCTGGATTCGG + Intergenic
1041499290 8:58522349-58522371 GATTTTTGCAGAGCTGGCTTGGG + Intergenic
1042413035 8:68486311-68486333 GCTTTAAGGAGGGCTGGCATTGG - Intronic
1043518088 8:81014890-81014912 GCTTTTGGAGGTGGTGGGTTGGG + Intronic
1043984561 8:86678844-86678866 GATTTTGGAAGGGTTGCCATTGG - Intronic
1045064353 8:98432393-98432415 CATTTTGGAAGTGCTGGGTTGGG + Exonic
1047214524 8:122865610-122865632 GCTAGTGGAAGGGCTGGGATGGG - Intronic
1047858348 8:128937120-128937142 TCCTTTGGGAGGGCTGGCTCTGG - Intergenic
1050830675 9:10008274-10008296 TCTTTTGAGAGGGCTGGTTTTGG - Intronic
1055228359 9:74029167-74029189 ACCTTTGGAAGAGCTGGTTTAGG - Intergenic
1057311047 9:93943442-93943464 GCTGCTGCAAGGGCAGGCTTTGG + Intergenic
1058452224 9:105107714-105107736 GCTTTTGGTAGTCCTAGCTTAGG - Intergenic
1058602203 9:106682312-106682334 GCTTTTGAATGGCCTTGCTTGGG + Intergenic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1061667573 9:132169343-132169365 GGCTTTTGGAGGGCTGGCTTTGG + Intronic
1061788441 9:133045012-133045034 GCTGTTGGAAAGGCAGGCCTGGG + Intronic
1061848615 9:133401935-133401957 GGTCTTGGAAGGGTTGGTTTGGG + Intronic
1185876410 X:3705634-3705656 CTTTTTGGAAGGGATGCCTTAGG + Intronic
1186739016 X:12497785-12497807 GGTGTTGGAAGGGCTGGGCTGGG + Intronic
1187940037 X:24372372-24372394 GGTTTTGGAAGGACTGTTTTGGG + Intergenic
1188995292 X:36877501-36877523 GCTTTGGGAGGGGCAGGGTTGGG + Intergenic
1189247105 X:39571759-39571781 ATTTTTGGAAGGGCTGGGTATGG + Intergenic
1190692063 X:52920384-52920406 GCGTGTGCAAAGGCTGGCTTGGG + Intergenic
1192027038 X:67465189-67465211 GGGTTTGGAAGGGGTGGCATTGG - Intergenic
1200049994 X:153423820-153423842 GTCTTTGCAAGGGCTGGCATGGG + Intergenic
1200125196 X:153810196-153810218 GCTTATGGAAGGGCTGTTCTGGG + Intronic
1200788970 Y:7283065-7283087 CTTTTTGGAAGGACTGCCTTGGG - Intergenic