ID: 1014151778

View in Genome Browser
Species Human (GRCh38)
Location 6:118065153-118065175
Sequence GTTCCATGTGATCACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014151778_1014151783 17 Left 1014151778 6:118065153-118065175 CCATTAATGTGATCACATGGAAC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1014151783 6:118065193-118065215 TGGAGAAAAAATCCTGCTGTTGG 0: 1
1: 0
2: 1
3: 23
4: 235
1014151778_1014151781 -3 Left 1014151778 6:118065153-118065175 CCATTAATGTGATCACATGGAAC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1014151781 6:118065173-118065195 AACTTTCCAGGTAGGCTGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014151778 Original CRISPR GTTCCATGTGATCACATTAA TGG (reversed) Intronic