ID: 1014151778

View in Genome Browser
Species Human (GRCh38)
Location 6:118065153-118065175
Sequence GTTCCATGTGATCACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014151778_1014151783 17 Left 1014151778 6:118065153-118065175 CCATTAATGTGATCACATGGAAC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1014151783 6:118065193-118065215 TGGAGAAAAAATCCTGCTGTTGG 0: 1
1: 0
2: 1
3: 23
4: 235
1014151778_1014151781 -3 Left 1014151778 6:118065153-118065175 CCATTAATGTGATCACATGGAAC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1014151781 6:118065173-118065195 AACTTTCCAGGTAGGCTGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014151778 Original CRISPR GTTCCATGTGATCACATTAA TGG (reversed) Intronic
901389913 1:8938229-8938251 GGTCCTTGTGATTACATTTAGGG - Intergenic
902815536 1:18914403-18914425 GGTCCATGTGGTTAAATTAAAGG - Intronic
904277821 1:29395695-29395717 ATTCAATGTGATCACGTTGATGG - Intergenic
905445870 1:38028250-38028272 GTTTCATGTTTTCACATTACTGG + Intergenic
906874042 1:49516289-49516311 GTGCCATGAGATCACATAAGAGG + Intronic
908151794 1:61310324-61310346 CTTCCATCTGATCACATTACTGG + Intronic
913674848 1:121130943-121130965 GATTCATGTGATTATATTAAGGG + Intergenic
914026687 1:143918575-143918597 GATTCATGTGATTATATTAAGGG + Intergenic
914665069 1:149826010-149826032 GATTCATGTGATTATATTAAGGG + Intergenic
914670696 1:149867811-149867833 GATTCATGTGATTATATTAAGGG - Intronic
917156876 1:172011944-172011966 GCTGCATGTGATAACATTTAAGG - Intronic
918489714 1:185068427-185068449 GTTACATGTGGTAACATTTAAGG - Intronic
920617033 1:207503625-207503647 GACCCTTGTGATCACATTTAAGG + Intronic
921433209 1:215086479-215086501 CTTCCATTTCATAACATTAATGG - Exonic
1064287603 10:14005609-14005631 GTTACCTGTGTTCGCATTAAAGG - Intronic
1065261048 10:23923503-23923525 GATGCCTGTGATCACATTTAGGG - Intronic
1072328215 10:94319398-94319420 GTTCCATGGGATAAAATAAATGG - Intronic
1072494648 10:95944919-95944941 TTTCAATGTGATAGCATTAAGGG + Intergenic
1074855125 10:117467657-117467679 GTTCCAGGTAATGTCATTAATGG + Intergenic
1075897233 10:126007249-126007271 GATCCATGTGATCTCAGGAAAGG + Intronic
1080926517 11:36762522-36762544 GTTGCAGGTGATGACATGAAAGG - Intergenic
1086897005 11:92324992-92325014 TTTAAATGTGATCAGATTAAAGG - Intergenic
1089468996 11:118705992-118706014 TTTCCCTGTTATCCCATTAAGGG - Intergenic
1094014258 12:25845738-25845760 CTTCCATGGGATCATAATAATGG - Intergenic
1094150275 12:27275111-27275133 ATTCCATGGCATCACATTCATGG + Intronic
1094274536 12:28656578-28656600 GTTCTATGTGAACAAATTTAAGG + Intergenic
1094292459 12:28867297-28867319 GTTTCATGTCATCAGATTGATGG - Intergenic
1096274772 12:50197033-50197055 GTTCAAGGTGACCAAATTAAAGG - Intronic
1098146036 12:67498868-67498890 GACCCAGGTGATCACATTAATGG - Intergenic
1098146246 12:67500322-67500344 TACCCAGGTGATCACATTAATGG + Intergenic
1098884957 12:75951432-75951454 GTTACATGTACTCACATAAATGG - Intergenic
1100016657 12:90019169-90019191 GTTCAACTTGATCACATTAGGGG - Intergenic
1100693748 12:97067388-97067410 GTTCTATCTGATTTCATTAAGGG - Intergenic
1101566143 12:105907506-105907528 GTTCCATATGATATCAATAAAGG + Intergenic
1103157287 12:118696834-118696856 GATACATGTGATGACATTTAGGG - Intergenic
1107586590 13:41855829-41855851 GTTCCATCTTATCACATTTTTGG - Intronic
1109796191 13:67316127-67316149 GATGCATGTGATCGCATTTAGGG + Intergenic
1111136020 13:84045010-84045032 CTTCAATGTAATCACACTAATGG - Intergenic
1111151975 13:84264697-84264719 GCTCAATGTTATCACATTCAAGG - Intergenic
1111858866 13:93675726-93675748 GTTCTAAGTGATCATATAAATGG - Intronic
1112942396 13:104879753-104879775 ATTCCATGTGTTCACATTTTAGG - Intergenic
1115075938 14:29390470-29390492 GTTCCATATAATTACCTTAATGG - Intergenic
1115912467 14:38271557-38271579 CTTCCATGTAAACACTTTAATGG + Intergenic
1116346263 14:43798429-43798451 GTTCTATGCGATCACAATATGGG - Intergenic
1121659956 14:95627438-95627460 CTCCCATGGGAACACATTAATGG + Intergenic
1121844019 14:97157621-97157643 GTCACTTGTGAGCACATTAAGGG + Intergenic
1124467868 15:29955504-29955526 ATTCTAAGTGATTACATTAATGG - Intronic
1126088231 15:45028961-45028983 CTTCTATGTGATCAGATTAAAGG + Intronic
1126834877 15:52651595-52651617 GTACAATGTGCTCACTTTAATGG - Intronic
1129977139 15:79831795-79831817 GCTCCATGTGAGCACATGGAAGG + Intergenic
1132092084 15:98955265-98955287 GTTCCATGTGGCCACTTTTATGG - Intronic
1135094519 16:19554367-19554389 GTTGCATGTGATAACATGCATGG + Intergenic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1142350936 16:89579685-89579707 GTTCCATGTGAGCAGATGACGGG - Intronic
1144238580 17:13287037-13287059 GCTCCATGTGCACACACTAATGG - Intergenic
1144341755 17:14315863-14315885 GTTCCATGTTAGCATATTAGAGG + Intronic
1148096374 17:45055094-45055116 TTTCCATGTGATGCCATCAAGGG + Intronic
1148989218 17:51650985-51651007 GTTCCCTGTGGTCACAGCAAGGG + Intronic
1157085470 18:44576347-44576369 GTCCCATGTGATGACAGTCAAGG - Intergenic
1163700633 19:18785033-18785055 GTTCCATGTGAACACGGTCACGG - Exonic
1166045747 19:40229713-40229735 GTGCCATTCTATCACATTAAAGG + Intergenic
1168665052 19:58198611-58198633 TTTCCATATGATCACAGTTATGG - Intronic
926627068 2:15100443-15100465 GTTATATATAATCACATTAATGG - Intergenic
928265307 2:29806351-29806373 GTTCCATGTGATAACAGCAGAGG + Intronic
931815938 2:65900656-65900678 GTTGCGTGTTATCACTTTAAGGG + Intergenic
934987378 2:98897562-98897584 GTTCCATGTAATCCAATGAAAGG + Intronic
939081472 2:137667480-137667502 GTACCATGTAATAACATTTAAGG + Intronic
939906478 2:147922160-147922182 GTTCAAGGAGAACACATTAAAGG - Intronic
940923557 2:159338059-159338081 GTTTCATGGGATCACTTAAATGG + Intronic
942838112 2:180325880-180325902 TTGCCATGTGTTCACATTCAGGG + Intergenic
946991514 2:225335938-225335960 GTTCCATGAGATGACAATCATGG - Intergenic
1169313064 20:4564055-4564077 TCTCCAAGTGGTCACATTAAAGG - Intergenic
1170015646 20:11778866-11778888 GTTCTATGTGATAACAGTGAAGG + Intergenic
1170337765 20:15289622-15289644 ATTTCATTTGATCACATGAAGGG - Intronic
1170773695 20:19357087-19357109 GATGCTTGTGATCACATTTAGGG - Intronic
1173967949 20:47127965-47127987 GTTGCATTTGATAAGATTAATGG + Intronic
1175135411 20:56819737-56819759 CTTCCCTGTGAACAAATTAATGG - Intergenic
1176051597 20:63122586-63122608 GGTCCCTGTGGTCACATTCATGG + Intergenic
1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG + Intergenic
1177335335 21:19717324-19717346 CTTTAATGTGATCATATTAAAGG + Intergenic
951844337 3:27069484-27069506 ATTGCATTTGATCTCATTAAAGG - Intergenic
952020329 3:29010743-29010765 GTTCCATGACTTCACATTAGTGG + Intergenic
953579084 3:44137167-44137189 GTGCCATCTGATGACACTAAAGG - Intergenic
955746661 3:62147354-62147376 GTTTTATGTGACCACAGTAAAGG - Intronic
957278477 3:78119322-78119344 GCTGCATGTGATCACATATATGG - Intergenic
957879549 3:86193503-86193525 GTTCTATTTGTACACATTAAGGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
961620139 3:128217518-128217540 GGTGCACGTGAACACATTAAAGG - Intronic
962069213 3:132015743-132015765 GTTCCATTTGATCCCTTCAATGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
966461236 3:180179157-180179179 TTTTAATGTGATGACATTAAAGG + Intergenic
977627740 4:99205995-99206017 GTTCTATGTCATGACATGAAGGG + Intronic
979579984 4:122346560-122346582 CTACCATGTGAAAACATTAAAGG + Intronic
980137369 4:128871723-128871745 TTTCATTGTGATCTCATTAAAGG + Exonic
987333595 5:16878545-16878567 GTTTCATGTGATTAAATCAAAGG - Intronic
988214574 5:28254403-28254425 ATTCCATCTGTTCACATGAAAGG - Intergenic
991127070 5:63081376-63081398 GTCCCAGGTGATCACCTTTATGG + Intergenic
994718438 5:103351845-103351867 GTTCCATGTAACACCATTAAAGG + Intergenic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
995947831 5:117671324-117671346 GACCCATGTGATTAGATTAAAGG - Intergenic
999353632 5:150903383-150903405 CTTCTATGTGATCATATTATAGG - Exonic
1004661487 6:17714161-17714183 GTTCAATTTGATAACAATAATGG + Intergenic
1005984995 6:30866178-30866200 GTTCCAGTTCATCACAATAAAGG + Intergenic
1010689418 6:78891319-78891341 GTTCTAAGTGATGACTTTAATGG + Intronic
1012672431 6:102071887-102071909 GTTCCATGTATTCAGATTATAGG + Intergenic
1013908771 6:115249177-115249199 GTTCCATGTATTCATATTCAAGG - Intergenic
1014151778 6:118065153-118065175 GTTCCATGTGATCACATTAATGG - Intronic
1017684143 6:156895114-156895136 ATACCATATCATCACATTAAAGG - Intronic
1018269779 6:162064888-162064910 GTCCCATGTGATGCCCTTAAGGG + Intronic
1023490792 7:40738708-40738730 GTTGTAAGTGATCAGATTAATGG + Intronic
1024058432 7:45681277-45681299 ATTCCAGGTGCTGACATTAAAGG + Intronic
1024549499 7:50550417-50550439 GTTCCAGGTGACCACCATAAAGG - Intronic
1024724815 7:52180595-52180617 TTTATATGTGATCACATTAAGGG - Intergenic
1025247165 7:57326087-57326109 GTACCATGTGACCACTGTAAGGG - Intergenic
1025483652 7:61018849-61018871 ATTCCATTTGATTACATTCAAGG + Intergenic
1027522321 7:79224739-79224761 TTTCCAAGTTATCACATAAATGG - Intronic
1031395929 7:121273631-121273653 GTTCCATTTGGTCATATTAAAGG - Intronic
1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG + Intronic
1036035397 8:5013143-5013165 GTTCTATGTGATGGCATTTATGG - Intergenic
1039373377 8:37009521-37009543 GTTACATGTGATTGCATTTAGGG - Intergenic
1039501268 8:38019457-38019479 CTTCCATGCGTTCTCATTAATGG - Intergenic
1041403873 8:57474541-57474563 GTTACATGTGTAAACATTAAAGG - Intergenic
1041473388 8:58235744-58235766 GATGCATGTGATTACATTTAGGG + Intergenic
1042066988 8:64888635-64888657 TTTCCATGTCAGCACATAAAGGG + Intergenic
1046094771 8:109544196-109544218 TTATCATGTGACCACATTAAAGG - Intronic
1046190860 8:110792290-110792312 GACCCAGGTGACCACATTAAAGG - Intergenic
1052395018 9:27928338-27928360 CTTCCCTGTTATCACAGTAAAGG - Intergenic
1056150866 9:83786686-83786708 GTTTGATGTGATGACATTGATGG - Intronic
1056295464 9:85188868-85188890 GGCCCATGTGATCTCATTAAAGG + Intergenic
1057813218 9:98273733-98273755 GCTCCATGAGATAATATTAAGGG - Intergenic
1059176364 9:112173322-112173344 TTTCCATGTGATGACATACAAGG - Intronic
1062179508 9:135183618-135183640 GTGCCATGTGGTCACTTTATTGG - Intergenic
1188953495 X:36406440-36406462 GTTACATGGGATGACAATAAAGG - Intergenic
1189563222 X:42212585-42212607 GCTCCACGTGATCACTTTAAGGG - Intergenic
1193250399 X:79283873-79283895 CTTCCATGTGATTATATAAAAGG + Intergenic
1195636691 X:107124802-107124824 GTTTCATATGATAAAATTAATGG - Intronic
1196186711 X:112751845-112751867 ATTCCATGAGAGCACATTCAGGG + Intergenic