ID: 1014162944

View in Genome Browser
Species Human (GRCh38)
Location 6:118191088-118191110
Sequence ATGCCCTTCTAGAAGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 3, 1: 14, 2: 52, 3: 55, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014162942_1014162944 2 Left 1014162942 6:118191063-118191085 CCATGGAAAAAGGACCTAAAACA 0: 1
1: 1
2: 44
3: 67
4: 314
Right 1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG 0: 3
1: 14
2: 52
3: 55
4: 144
1014162939_1014162944 18 Left 1014162939 6:118191047-118191069 CCTCTTTTATTCCAAACCATGGA 0: 8
1: 29
2: 32
3: 52
4: 208
Right 1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG 0: 3
1: 14
2: 52
3: 55
4: 144
1014162941_1014162944 7 Left 1014162941 6:118191058-118191080 CCAAACCATGGAAAAAGGACCTA 0: 14
1: 15
2: 18
3: 7
4: 111
Right 1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG 0: 3
1: 14
2: 52
3: 55
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014162944 Original CRISPR ATGCCCTTCTAGAAGAGTAA AGG Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
905503615 1:38459027-38459049 TTGCCCCTCTAGGAAAGTAAAGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907639619 1:56174257-56174279 ATGCCATGGTAGCAGAGTAAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908960574 1:69692443-69692465 ATGCCCTTCTAGCTGTCTAAAGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
913261766 1:117005024-117005046 ATGCCCTTGTAAAAGAGTCCAGG - Intronic
913427053 1:118744794-118744816 ATAACCTTGTAGAAAAGTAAAGG - Intergenic
913578632 1:120203556-120203578 ATGGCCTTAGAGAAAAGTAAGGG + Intergenic
913629541 1:120694797-120694819 ATGGCCTTAGAGAAAAGTAAGGG - Intergenic
914560561 1:148814995-148815017 ATGGCCTTAGAGAAAAGTAAGGG + Intronic
914612273 1:149315224-149315246 ATGGCCTTAGAGAAAAGTAAGGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917882225 1:179348491-179348513 ATGACATTCTAGTAGGGTAAGGG + Intronic
918001424 1:180501170-180501192 ATGCCCTTCTTTTACAGTAAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919254258 1:195100507-195100529 ATCCCCTTTGAGAAGGGTAAGGG + Intergenic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
920433164 1:205931824-205931846 ATGCCCTTCTAGCAGGGTTGGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065778960 10:29149007-29149029 AAGGCCTTGCAGAAGAGTAAGGG - Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066439621 10:35425904-35425926 CTGCCCTCCTAGAAGAGAATTGG - Intronic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067371752 10:45690441-45690463 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067388029 10:45835708-45835730 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067418092 10:46121572-46121594 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067446236 10:46348893-46348915 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067503451 10:46828135-46828157 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067591142 10:47511878-47511900 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067638260 10:48019970-48019992 ATGCCTCTCCATAAGAGTAAGGG + Intergenic
1067875234 10:50000391-50000413 ATGCCTCTCCATAAGAGTAAGGG - Intronic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070134865 10:73684396-73684418 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1074606551 10:114975192-114975214 ATGCCCTTCCTGAAGACAAATGG + Exonic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1079755940 11:24262208-24262230 ATGCCCTTATAAAAGAGGACTGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086185868 11:84015047-84015069 ATGCTATTCTACAAAAGTAAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088196852 11:107283738-107283760 ATGACATTTTTGAAGAGTAAGGG + Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1089930895 11:122310491-122310513 ATGCACTTCTGGAATAGAAATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091726373 12:2849223-2849245 AAGCCCTTCTAGAAGTGTCCAGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1095323415 12:40858249-40858271 GGGCCCTTCCAGAAGAGAAAGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1098949106 12:76620780-76620802 AAACCCTTGAAGAAGAGTAAGGG - Intergenic
1099091505 12:78316187-78316209 ATGCCCTTCTAGGAAGGGAAGGG + Intergenic
1099341104 12:81435892-81435914 ATTGCCATCTTGAAGAGTAAGGG - Intronic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103758584 12:123231824-123231846 ATGCACTTATAAAAGAGCAAGGG + Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113303085 13:109044595-109044617 ATTCACTTCTAGAAAATTAATGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121249863 14:92491489-92491511 ATGCCCTTCCTGAAGCCTAAAGG - Intronic
1121265093 14:92596611-92596633 ATCCCCTGCTAAAAGAGGAACGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1124816839 15:33002210-33002232 ATGCCTTTCTAGAATAAGAAGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133645747 16:7763010-7763032 ATGCTCTACTAGAAGACAAAAGG - Intergenic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1142485362 17:244298-244320 ATGCCCTGTTGGAAGAGGAAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147356965 17:39905836-39905858 ATGCCCTGCTAGGTGAGGAAGGG - Exonic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1163766634 19:19166764-19166786 CTGCCCTTCTGGAAGATTCAAGG - Intronic
1164042091 19:21502033-21502055 ATACCCATTCAGAAGAGTAATGG - Intronic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164245421 19:23424237-23424259 ATGGCCATTCAGAAGAGTAAGGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165672176 19:37688755-37688777 CAGCCCCTCTGGAAGAGTAAAGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
935914372 2:107933552-107933574 ATGCCCCTCTAAAAGATCAAGGG + Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
939655435 2:144818569-144818591 ATTCCTTTCTAGAAATGTAAAGG + Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
947582228 2:231327567-231327589 ATGCCCTTCAACAAGAGAACAGG - Intronic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173427534 20:42955987-42956009 ATTCCCTTCCAGGAGAGGAAGGG + Intronic
1174432162 20:50478361-50478383 ATGCCCTTCGAGGAGGATAAGGG - Intergenic
1175078115 20:56392868-56392890 AGGCCCTTCGAGAAGAGGAAGGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177693893 21:24546642-24546664 ATACAATTCTAGAAGAGCAAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184631685 22:45786238-45786260 ATGCTTTTCAAGAATAGTAATGG - Intronic
1184760093 22:46538760-46538782 AAGCCCTTCTAGGAGAGAAGAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950622937 3:14221711-14221733 CTGCCCTGCAAGAAGTGTAAAGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
954934798 3:54316818-54316840 ATTCCCTTCTAGAAGTCTATTGG + Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959776949 3:110176856-110176878 ATGCCCTTATAAAAGAGAAAGGG - Intergenic
960966087 3:123105687-123105709 GTGCCCTTCTATAATAGTAAGGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
964451648 3:156818257-156818279 ACTACATTCTAGAAGAGTAAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965734535 3:171806998-171807020 ATGCACTTTTAAAAGAGAAAAGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969063705 4:4460488-4460510 AGGCCCTTCTAAAAAAGAAAGGG + Intronic
970201270 4:13609647-13609669 ATGGCATTCTTAAAGAGTAATGG - Intronic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973033831 4:45379871-45379893 CTCCCCTGCTAGAAGAATAATGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
974550296 4:63363394-63363416 CTGCTCTTCTAGATGAGTTATGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
980851942 4:138393666-138393688 ATCCCCTACTAGAAGAGCATTGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981715946 4:147752186-147752208 ATGCTCTTCTATAATACTAAAGG - Intronic
987854984 5:23409483-23409505 ATGGAATTCTAGAAGAGAAAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
997858774 5:137397209-137397231 ATGACCCTCTAGAACAGCAATGG + Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008018899 6:46553429-46553451 ATTCCTTTCTAGAAAAATAAGGG + Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008651400 6:53567080-53567102 ATGCCCTACTCGAAGGGAAATGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012949194 6:105499994-105500016 AAGCCATCCTAGAAGAGAAATGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020564310 7:9776938-9776960 ATGCACTGCTGGAAGAGGAAGGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1025801572 7:64791423-64791445 ATGCTTATTTAGAAGAGTAATGG - Intergenic
1025864612 7:65369271-65369293 ATGCCCATTCAGAGGAGTAATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030861048 7:114629723-114629745 ATGCCAGTCTAGAAGAGTTTAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044186882 8:89263974-89263996 ATCCCCATCTAGAAAAGTACAGG - Intergenic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046418277 8:113943849-113943871 ATGCGGTTATAGAAGAGTAGTGG - Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1048627606 8:136202913-136202935 ATGCCCTTCTATAAAATTACCGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1057015216 9:91645124-91645146 AGGCACCTCCAGAAGAGTAAGGG + Intronic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1059586329 9:115611303-115611325 GATCCCTTCTAGAAGAGCAAAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1194617956 X:96130735-96130757 ATGCCCTAAAAGAAGAGAAATGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201524813 Y:14920353-14920375 ATGCCCTTTGAGAAGGGAAAAGG - Intergenic