ID: 1014166283

View in Genome Browser
Species Human (GRCh38)
Location 6:118228729-118228751
Sequence CTCTTTTACCAGAACTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014166283_1014166287 29 Left 1014166283 6:118228729-118228751 CCTTTGGAGTTCTGGTAAAAGAG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1014166287 6:118228781-118228803 AAAAGGTGTTTATTCAAGTAAGG 0: 1
1: 0
2: 1
3: 16
4: 429
1014166283_1014166285 12 Left 1014166283 6:118228729-118228751 CCTTTGGAGTTCTGGTAAAAGAG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1014166285 6:118228764-118228786 CATCACACTGTGAGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014166283 Original CRISPR CTCTTTTACCAGAACTCCAA AGG (reversed) Intronic
900912035 1:5604673-5604695 CTCTTTTGATAAAACTCCAATGG + Intergenic
903993751 1:27291997-27292019 CTATTCTACTAGAACTCCTAAGG - Intronic
907679484 1:56550336-56550358 CTCTTTTGCCAGAACTCTCCAGG + Intronic
907784227 1:57596145-57596167 CTCTCCTTGCAGAACTCCAAGGG + Intronic
909074400 1:71036220-71036242 CTCTTTGACCAGAAGTCCCTGGG - Intronic
909290347 1:73875043-73875065 CTCTCTTACCAGAAGCACAAAGG - Intergenic
909433750 1:75616822-75616844 CTCTTTTCCCACAGCCCCAAGGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
919343015 1:196337662-196337684 CTCTTTCTCCAGACCTCCACAGG + Intronic
921122936 1:212152447-212152469 CTGTTTTGCCAGAAATACAAAGG - Intergenic
921269544 1:213455160-213455182 CTCTTTAATTAGAACTTCAAAGG + Intergenic
1064556277 10:16550074-16550096 CACTATCACCAGAACACCAAGGG - Intergenic
1066998244 10:42583058-42583080 CTCTTCTTCCAGCACTGCAAGGG + Intronic
1067923068 10:50479725-50479747 CTCTTTTAGCACACCACCAAGGG + Intronic
1068519922 10:58066802-58066824 CCCTCTTCCCAGAAATCCAATGG + Intergenic
1068848221 10:61704902-61704924 TTTTTTAACCAGAAATCCAAGGG - Intronic
1074599740 10:114901425-114901447 CTCTTTAAAAAGAACTCCAATGG + Intergenic
1075190156 10:120299797-120299819 ATCTTTGGCCAGAACTCCAAGGG - Intergenic
1076669242 10:132110614-132110636 CGCTTTTTCCAGAACTCACAGGG - Intronic
1078864700 11:15286554-15286576 CCGTTTTACAAGAACCCCAAGGG + Intergenic
1082296193 11:50443713-50443735 CTCTTTTACCTCTACTCAAAAGG + Intergenic
1082686415 11:56243883-56243905 CACTATTACCAGAACAGCAAGGG - Intergenic
1086354257 11:85977176-85977198 CTCTTTTCAAAAAACTCCAAAGG + Intronic
1087553189 11:99678589-99678611 TGCTTTGACCAGAGCTCCAATGG + Intronic
1087629393 11:100632880-100632902 ATCTTTTTCCAGAGATCCAAAGG - Intergenic
1088177230 11:107067105-107067127 CTATTTTTCCAGAACTCCTGAGG + Intergenic
1088809580 11:113382123-113382145 CCCTATTACCAGGACTCTAAAGG - Intronic
1093594171 12:20941638-20941660 CTCATTTACCAGAAATTCTAGGG + Intergenic
1096586098 12:52620968-52620990 CTCACTTCCCAGAACTCCAGTGG + Intergenic
1097116619 12:56702039-56702061 CAGTTGTGCCAGAACTCCAAAGG - Intergenic
1098202663 12:68072892-68072914 CAGCTTTACAAGAACTCCAACGG - Intergenic
1101540007 12:105656401-105656423 CTCTATTACAAGAACAGCAAGGG + Intergenic
1103419733 12:120770691-120770713 CTCAATTCCCAGAACTCCACGGG + Intronic
1104685077 12:130779559-130779581 CTCCTTCCCCAGAAATCCAAGGG + Intergenic
1105664922 13:22543407-22543429 ATCTTGTACCAGAACTACATAGG - Intergenic
1106532554 13:30607372-30607394 CTCTTTCACAAGAACAGCAAGGG - Intronic
1106837397 13:33649737-33649759 CTCTTTTACCCTAACTACCAAGG - Intergenic
1109342551 13:61079513-61079535 GTCTCTTACCAGAACTTAAAAGG - Intergenic
1109501276 13:63238863-63238885 ATTTGTTACCAAAACTCCAAGGG - Intergenic
1109679348 13:65728897-65728919 ATCTTTTACCAAAAATTCAATGG + Intergenic
1109849067 13:68036654-68036676 CTCTTTTGACAGAAATCAAAAGG + Intergenic
1111957042 13:94770783-94770805 CTATTTGAGCAGAAATCCAAAGG + Intergenic
1113477024 13:110591126-110591148 CTCCTTTCTCAGGACTCCAATGG + Intergenic
1113857529 13:113456192-113456214 CTCTGCTTCCAGAACTCTAATGG - Intronic
1115422192 14:33208489-33208511 CTATTTTACCACAAGTCAAATGG + Intronic
1116785439 14:49282570-49282592 ATTTTTTTCCAGCACTCCAAAGG - Intergenic
1120475794 14:84985193-84985215 CACTATTACCAGAACAGCAAAGG + Intergenic
1120683179 14:87505862-87505884 CTCTTTTACCATAACTAAAGGGG + Intergenic
1121856548 14:97275769-97275791 CACATTTACCTGAATTCCAATGG + Intergenic
1125328712 15:38562896-38562918 TGCTTTTACCAGAACTAGAAGGG + Intronic
1126207278 15:46059862-46059884 CTCTCGCACCAGAACTCCATGGG - Intergenic
1126615885 15:50579490-50579512 CTCTTTTCTCAGCACTCAAAGGG + Intronic
1128461254 15:67869461-67869483 CTCATTAAACAGAACTTCAAAGG + Intergenic
1131248506 15:90816365-90816387 CTCTCTTGCCTGAACTCCAGTGG + Intergenic
1131559419 15:93426573-93426595 CTCTGTTTCCAGAACTTCATGGG - Intergenic
1133512054 16:6469128-6469150 TTCTTTTGACAGAACTCCAATGG - Intronic
1136107450 16:28040264-28040286 CTCTTTCTCCAGATCTCCACAGG + Intronic
1139797757 16:69497058-69497080 CTTATTCACCAGAACTGCAAGGG - Intergenic
1145032130 17:19512337-19512359 CCCTTGTACCTGAATTCCAAAGG - Intronic
1146657067 17:34640795-34640817 CTCTCTTATAAGAACTCCAAGGG - Intergenic
1148584409 17:48767262-48767284 CTCTTATGCCAGAATTCCCAGGG + Intronic
1151329659 17:73399279-73399301 CTCCTTTTCCAGAACTCCCAGGG - Exonic
1151822145 17:76502134-76502156 CTCTCTTCCCTGGACTCCAAGGG + Intergenic
1153440961 18:5118401-5118423 CTCTATTACAAGAACAGCAAGGG - Intergenic
1156758020 18:40552082-40552104 CTCTTTGACCAGAACTGGATAGG + Intergenic
1161180424 19:2877264-2877286 CATTTTTAGCAGAAATCCAAGGG + Exonic
1161505970 19:4643628-4643650 CTCTTTTGCCATAACTAAAATGG + Intronic
1162996665 19:14340125-14340147 CTGGTTTGCCTGAACTCCAAAGG - Intergenic
1164431273 19:28190912-28190934 CAGTTTTACCTAAACTCCAAAGG - Intergenic
1164627783 19:29740935-29740957 CTCCTTAACCAGACCTCTAAAGG - Intergenic
1166762010 19:45230731-45230753 CTGTGTTTCAAGAACTCCAAAGG + Intronic
1167714759 19:51135689-51135711 CTCTTTTTCCAGGATTCCAGTGG + Intronic
1168062854 19:53903116-53903138 CTCATACAGCAGAACTCCAAAGG - Exonic
925921426 2:8640637-8640659 CTCTTCCTCCATAACTCCAATGG - Intergenic
927829853 2:26340195-26340217 CTGTTTGACCAGAACTCTAATGG - Intronic
928448487 2:31354818-31354840 CTTTTCTTCCAGATCTCCAATGG - Intronic
931647355 2:64436722-64436744 CTCTTTTCACAGACCTCCACTGG + Intergenic
934126436 2:88897330-88897352 TTCTCTTACCAGAGATCCAAAGG - Intergenic
934500311 2:94856010-94856032 TTCTTATACCAGAAATGCAAAGG + Intergenic
937941266 2:127288012-127288034 CTTTTTTTCCAAAACTCCAAGGG - Intronic
939546459 2:143560669-143560691 CAATTTTAGCAAAACTCCAACGG - Intronic
941549721 2:166900091-166900113 CTCTTTTTCTGGAAATCCAATGG + Intronic
943643223 2:190381669-190381691 CTATGTGACCAGAACTGCAAGGG - Intergenic
944104684 2:196067232-196067254 CACTTTTACCACATTTCCAATGG - Intronic
944266029 2:197727749-197727771 CCCTTTTATCAAAATTCCAAAGG + Exonic
944340913 2:198597833-198597855 CTCTTTTATCATAGCTCGAAGGG + Intergenic
944856023 2:203767653-203767675 TGCTATTACCAAAACTCCAAGGG - Intergenic
947113154 2:226741864-226741886 ATCTATTACCAGAACTATAAAGG - Intronic
1168785040 20:531317-531339 CTCTTTTAACAGACACCCAATGG + Intronic
1168854518 20:999396-999418 CTATTTGACCAGAACTCCTGTGG + Intronic
1168928307 20:1600577-1600599 CTCAATTAGCAGAACTCTAAGGG + Intronic
1173811548 20:45958949-45958971 CTCTTATACAAGAATTCCACAGG - Intronic
1174913879 20:54635096-54635118 CAGTTTTGCCTGAACTCCAAAGG - Intronic
1177573029 21:22913143-22913165 CTTCTTTACCAGAAATCCAATGG - Intergenic
1177785335 21:25665354-25665376 CTGTATTGCCAGACCTCCAAAGG + Intronic
1177866828 21:26522332-26522354 AGCTTTTATCAGAACTTCAAAGG + Intronic
1179611393 21:42554050-42554072 TTTTTTTACCAGCACTCAAAAGG + Exonic
1181161900 22:20964617-20964639 GTCATTTACCAGAACTCCTTGGG - Intergenic
1182859664 22:33548169-33548191 CTCTATCACCAGAATACCAAGGG - Intronic
1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG + Intronic
1184933350 22:47698430-47698452 CTGTTGTGCCTGAACTCCAAAGG + Intergenic
950543933 3:13627876-13627898 TTCTTGTGCCAGAACACCAAGGG + Exonic
951393439 3:22135754-22135776 CTTTTTTACCAAAACTACAATGG - Intronic
952920555 3:38281134-38281156 CTCTTTCACCAGACCTCCCTCGG - Intergenic
953492031 3:43360705-43360727 CTCTGTTACCAGAAGGTCAAAGG - Intronic
955732098 3:61997856-61997878 CCCTTTTACCAGGAGTCCCAGGG + Intronic
955795068 3:62627719-62627741 CTCAATTACCAGAACTTCACAGG - Intronic
957921183 3:86750262-86750284 ATCTTATACCTGAATTCCAAAGG - Intergenic
962130653 3:132670727-132670749 TTATTTTACAAGAACTACAAGGG - Intronic
963030648 3:140971648-140971670 CTCAGTTCCCAGAACACCAAAGG - Intronic
966389299 3:179435008-179435030 CTCTTGTACCTGAAGTCCACTGG + Intronic
966452449 3:180077765-180077787 CTCTATTTTGAGAACTCCAAGGG + Intergenic
967346066 3:188457208-188457230 CTCCTTTGCCAGATCTCCCAGGG - Intronic
971142271 4:23937116-23937138 CTCTTTTACCAGAACAGAGAGGG + Intergenic
971667813 4:29513950-29513972 CTCTTTTTCTAGATCTTCAAGGG + Intergenic
972919338 4:43919133-43919155 CTATTTTGCCAGAACTTCAGAGG + Intergenic
975794407 4:77991525-77991547 CTCTTTCATCAGAACTGCTATGG + Intergenic
976369491 4:84270650-84270672 CTCTTTTCCCAGAGCTTCAGAGG + Intergenic
977860897 4:101958540-101958562 CTATTTTTCCAGAATTTCAAAGG + Intronic
978690029 4:111496998-111497020 CACTATTACCAGAACAGCAAAGG - Intergenic
979535049 4:121810161-121810183 GTCTTTTAACAAAAATCCAATGG + Intronic
981147275 4:141339797-141339819 TTCTGTTACCAAAACTCCAGGGG - Intergenic
981867703 4:149444474-149444496 CTCTTTTAGAAGAAACCCAAAGG - Intergenic
983020667 4:162671766-162671788 CACTATTACAAGAACACCAAGGG - Intergenic
987491092 5:18581185-18581207 CACTTTCACCATAACTACAAGGG - Intergenic
989237259 5:39162750-39162772 CTGTTTTACCATAACTTCACTGG + Intronic
991016250 5:61935769-61935791 CTCTGTTACCAGAGCACAAATGG - Intergenic
991513981 5:67413497-67413519 CACTTTTACCAGCAATCTAAGGG + Intergenic
991589695 5:68237402-68237424 TTCTGTTACCTGAATTCCAAGGG + Intronic
993518840 5:88873076-88873098 GTGTTAGACCAGAACTCCAACGG - Intronic
997783623 5:136685578-136685600 CTCTTGTCCCAGGACTGCAATGG - Intergenic
998667079 5:144309614-144309636 ATCTGTATCCAGAACTCCAAGGG - Intronic
1000394126 5:160755262-160755284 CACTTTTACAAGAACAGCAAGGG + Intronic
1001255938 5:170183688-170183710 CTTTTTGACCAGAAGTCCAGAGG - Intergenic
1002652647 5:180712740-180712762 CAGTTTTGCCTGAACTCCAAAGG - Intergenic
1004820289 6:19360703-19360725 CTCTTTTACCTGAAACCCAGTGG - Intergenic
1005245278 6:23876977-23876999 CTTTTTTACCAGAAATGCCAAGG - Intergenic
1006457116 6:34138253-34138275 CTCTTTTTGCTGAACCCCAAGGG - Intronic
1008902844 6:56642369-56642391 CTCCTCTACCACAACCCCAATGG + Intronic
1008957403 6:57230833-57230855 ATCTTTTACCTCAACTCCCAGGG + Intergenic
1009654850 6:66529176-66529198 CTCTTTTTCCAAAACTCATATGG + Intergenic
1011534818 6:88365333-88365355 CTCTTTCACCAAAACAACAAAGG + Intergenic
1011725861 6:90209983-90210005 CCTTTTTAAAAGAACTCCAAAGG - Intronic
1014166283 6:118228729-118228751 CTCTTTTACCAGAACTCCAAAGG - Intronic
1016648812 6:146440608-146440630 CTCTTCTACCAGAGCTTCCAGGG - Intergenic
1018556300 6:165054179-165054201 CTCTTTTCATAGAATTCCAATGG + Intergenic
1019068190 6:169320307-169320329 CAGTTGTGCCAGAACTCCAAAGG - Intergenic
1019831774 7:3337390-3337412 CTCTTTTATCATCACTCCAGAGG - Intronic
1020655712 7:10926291-10926313 CTCGTTTACCAGAAATTCTAGGG - Intergenic
1027686303 7:81282201-81282223 CACTTTTCCCAGGGCTCCAAAGG + Intergenic
1032300671 7:130683285-130683307 CTCTTGTAGCAAAACTCCACTGG - Intronic
1036392901 8:8340106-8340128 CTCTTTTGCCAAAGCTTCAAAGG + Intronic
1039177001 8:34820014-34820036 GTCTTTTACCTGAAGTCAAATGG - Intergenic
1043263454 8:78231204-78231226 CACCTTTACCAGCACTTCAAGGG + Intergenic
1044387399 8:91605605-91605627 CACTTTTGTCATAACTCCAATGG + Intergenic
1045884964 8:107084769-107084791 CTTGTTTACCAGAATGCCAATGG + Intergenic
1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG + Intergenic
1048722385 8:137340736-137340758 CTTCTTTACCAGCACTCAAAAGG + Intergenic
1048830949 8:138476990-138477012 CTCTCTCACAAGAACTCCATAGG - Intronic
1049983152 9:923261-923283 CTCTTGATCCAGAACGCCAAAGG + Intronic
1052472000 9:28910559-28910581 CTCTATCACCAGAACAGCAAGGG - Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1055874158 9:80922770-80922792 CTCTATCACCAGAACAGCAAGGG + Intergenic
1057190023 9:93082004-93082026 CACTTGTACCAGAGCTCCCAGGG - Intronic
1193820205 X:86151977-86151999 CTCTTTAGCCAGATCTCCATTGG - Intronic
1193941050 X:87681400-87681422 CTGTATTACTATAACTCCAAAGG - Intergenic
1194552731 X:95321260-95321282 CTCCTGTCCCAGACCTCCAAGGG - Intergenic
1196197538 X:112851788-112851810 CCCTTGCACCAGAACTCCCAGGG + Intergenic
1197457484 X:126695813-126695835 CTATTTTAGCAGTACTCTAAAGG - Intergenic
1197790534 X:130249410-130249432 CTCTTGTCCCAGCACGCCAATGG - Intronic
1198012259 X:132569300-132569322 ATGTTTTACCATGACTCCAAAGG - Intergenic
1198437351 X:136630165-136630187 CTCTTTTATCTAAACTCCTATGG - Intergenic
1198866714 X:141130842-141130864 CTGTTTTAACAGAAATGCAATGG - Intergenic
1198914461 X:141652535-141652557 CTCTTTTAGGAAATCTCCAATGG + Intronic
1199655293 X:149988696-149988718 CTCTTATACCAGAACTAGATTGG - Intergenic