ID: 1014170917

View in Genome Browser
Species Human (GRCh38)
Location 6:118278245-118278267
Sequence TCCACAGTGAGCACAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014170912_1014170917 17 Left 1014170912 6:118278205-118278227 CCCTAAAAGGGACTGACATTTGC 0: 1
1: 0
2: 0
3: 21
4: 157
Right 1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1014170915_1014170917 -8 Left 1014170915 6:118278230-118278252 CCCTCAGAAGGTGTCTCCACAGT 0: 1
1: 0
2: 4
3: 19
4: 135
Right 1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1014170916_1014170917 -9 Left 1014170916 6:118278231-118278253 CCTCAGAAGGTGTCTCCACAGTG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1014170913_1014170917 16 Left 1014170913 6:118278206-118278228 CCTAAAAGGGACTGACATTTGCT 0: 1
1: 0
2: 2
3: 23
4: 189
Right 1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014170917 Original CRISPR TCCACAGTGAGCACAGAACG TGG Intronic
902117514 1:14133598-14133620 ACCACACTGAGCACAGAAGTGGG - Intergenic
902195525 1:14795327-14795349 TCCACAGAGAGCACAACACGGGG + Intronic
904894151 1:33801559-33801581 TCCACAGTTAGCACAGTGCTGGG - Intronic
905343454 1:37295203-37295225 TCTACAGAGAGCACTGAACTTGG + Intergenic
906154214 1:43604688-43604710 TCCACAGTGAGCACCAAACAGGG - Intronic
906318223 1:44801549-44801571 TCCTCAGGGAGCACAGATGGAGG + Intronic
906785981 1:48616376-48616398 TCCAGAGTGAGAAAAGAACAGGG + Intronic
906950934 1:50333845-50333867 CCCCGAGTGAGCACAGAGCGCGG - Intergenic
906988071 1:50708189-50708211 GCCACAGTGAGCAAAGACTGGGG + Intronic
907270126 1:53286201-53286223 TCCACAGGAAGCACAGCATGGGG + Intronic
911076825 1:93883879-93883901 TCAACAGTGAGCAAAGAAAGAGG + Intergenic
911730754 1:101290120-101290142 TCCACAGTAAGCAAAGCATGGGG + Intergenic
912385296 1:109268453-109268475 GCAACAGTGAGCACAGAGGGAGG + Intronic
913076691 1:115346083-115346105 TGCACAGGGAGCACAGCACTAGG - Intergenic
917967249 1:180186519-180186541 TTCCCAGTGACCACAGAAAGGGG - Intronic
919427999 1:197458068-197458090 TCCTCAGGGATCACCGAACGAGG + Intronic
1067748887 10:48957160-48957182 TCCACAGTGTGAAGAGCACGTGG + Exonic
1069860943 10:71471475-71471497 ACCACAGAGAGCACATAAAGGGG - Intronic
1072318229 10:94223726-94223748 TCAATAGTAAGCACAGAATGAGG - Intronic
1074115492 10:110454879-110454901 TCCACAGTTAAGACAGAGCGGGG - Intergenic
1076011101 10:126989218-126989240 ACCAGAGTGAGCTCAGTACGTGG + Intronic
1076046405 10:127297483-127297505 TAGGCAGTGAGCACAGAAGGAGG + Intronic
1078511113 11:11984901-11984923 TCCACAGTGAGGACGGAAAGGGG + Intronic
1079862359 11:25689253-25689275 TCCATAGGTAGCACAGAATGAGG - Intergenic
1083553635 11:63609160-63609182 TCCACACTCACCACAGAATGTGG - Intronic
1086848709 11:91783319-91783341 TCCACACTGAACACAGCACAGGG + Intergenic
1088561936 11:111124135-111124157 TTCACAGTGAGCTGAGAACTAGG - Intergenic
1088716729 11:112555449-112555471 CCCACAGTGGGCACTGAACAAGG - Intergenic
1091918995 12:4289591-4289613 TCCACAGGGCACACAGAATGGGG - Intronic
1092312600 12:7374575-7374597 CCCAAAGTGAGCAGAGACCGTGG + Exonic
1097845242 12:64359630-64359652 TCCACTGTGAGCACTGAACAGGG + Intronic
1098897786 12:76083866-76083888 TTCAAAGTAAGCACAGACCGAGG + Intronic
1099149022 12:79085495-79085517 TCCACTGTGAGCACTGGAGGAGG - Intronic
1101626046 12:106442798-106442820 TCCACAGAGATCACAGATCCTGG + Intronic
1102228611 12:111247189-111247211 TCCATAGCGAGCACCGCACGTGG + Intronic
1103554608 12:121758574-121758596 TCCATGGTGACCACAGCACGGGG - Intronic
1103554667 12:121758796-121758818 TCCATGGTGACCACAGCACGGGG - Intronic
1103554685 12:121758870-121758892 TCCATGGTGACCACAGCACGGGG - Intronic
1103554695 12:121758907-121758929 TCCATGGTGACCACAGCACGGGG - Intronic
1104367916 12:128194656-128194678 ACCACAGTAATCACAGAACTTGG - Intergenic
1112416515 13:99207546-99207568 GCCACAATGAGCCCAGAACAGGG - Intronic
1119334229 14:73819088-73819110 CCCACAGGGAGAACAGGACGCGG - Intergenic
1119785428 14:77310023-77310045 TCCACAGTGCGCTGAGAACCAGG + Intronic
1122915529 14:104856647-104856669 TCCACAGCGAGCAAAGACCGTGG - Intergenic
1124710267 15:32004044-32004066 TGCACAGTGAGCACAGAATAAGG - Intergenic
1126559762 15:50030491-50030513 GCTACACTGAGCACAGAATGGGG + Intronic
1131597337 15:93811789-93811811 TCCTCTGTGTGCACAGAACCTGG + Intergenic
1133782580 16:8951432-8951454 TCCACAGAGAACACAGCCCGGGG + Intronic
1135135658 16:19884309-19884331 TCCACAGTCAGCCCCCAACGCGG + Intronic
1135630431 16:24032182-24032204 CCCACAGTGGTCACAAAACGTGG - Exonic
1136065489 16:27755495-27755517 TCCACAGGGAGCTCGGAACCTGG + Intronic
1138292925 16:55863291-55863313 TCCTCAGTTAGCAGAGAATGTGG - Intronic
1139564138 16:67762829-67762851 CCCATAGTGAGCACAGCACCTGG - Intronic
1142480681 17:216355-216377 TCCACAATTATCACAGAATGGGG + Intronic
1144320975 17:14119445-14119467 TCCACTGAGAGCAAAGATCGTGG - Intronic
1144734955 17:17550139-17550161 AGCACAGTGAGCACAGAACATGG - Intronic
1149513947 17:57265876-57265898 TCCAAAGGGAGCAAAGAACAGGG - Intronic
1150599867 17:66641401-66641423 CCCACAGTGATCGCAGAAGGTGG - Exonic
1150696778 17:67412219-67412241 TCCAAACTGAGCACAGGACTTGG + Intronic
1151935787 17:77260034-77260056 TCCTCAGTGCCCAGAGAACGAGG + Intergenic
1152946122 17:83198566-83198588 CCCACAGTGAGCGAAGAACCAGG + Intergenic
1153911895 18:9711874-9711896 TCCCCACTGAGCACAGTACCAGG - Intronic
1156536729 18:37871609-37871631 TCCTCAGTCTGCACAGAAAGAGG - Intergenic
1158421529 18:57299145-57299167 TGCAGAGTGAGTATAGAACGAGG + Intergenic
1158471745 18:57743228-57743250 ACCACAGAGAGCACAGAGCTGGG - Intronic
1162195830 19:8983912-8983934 TACACAGTGGGCAAAGGACGTGG - Intergenic
1165901575 19:39171801-39171823 GCCACAGTGAGCTGAGAACGTGG - Intronic
1167344839 19:48938896-48938918 TCCACAGTGGGCAGATCACGAGG - Intronic
1167472335 19:49682254-49682276 ACCACGGTGAGCCCAGAAAGAGG + Exonic
1168473124 19:56656799-56656821 TGCACTGTGAACACAGAATGTGG + Intergenic
925458029 2:4034888-4034910 ACCACAGTGAGCACATGACTTGG - Intergenic
928290290 2:30030713-30030735 TCCACTGTGAGCACTGGACTCGG - Intergenic
928615515 2:33035028-33035050 TGCACAATGAGCAAAGAAGGTGG - Intronic
929232046 2:39569909-39569931 TCCTCTGTGAGAAAAGAACGTGG - Intergenic
930000738 2:46859979-46860001 TCCTCAGTGACCCCAGAAGGAGG + Intergenic
932720239 2:74133525-74133547 CCAACAGTCAGCACAGAATGAGG - Intronic
934718104 2:96554792-96554814 TCCTCAGTGAGCAGAGACTGAGG + Intergenic
935863180 2:107356624-107356646 TCCACAGAGAGCAGAGCACTAGG - Intergenic
936019324 2:108982860-108982882 TTCACAGTGGCCACAGAACAAGG + Intronic
936513707 2:113168433-113168455 TCCACACAGAGCACAGACCAGGG - Intronic
937236247 2:120433327-120433349 TTCACAGTGACCACAGAAGGTGG - Intergenic
941783216 2:169471645-169471667 CCAACATTGAGCACAGAACCAGG + Intergenic
944438491 2:199717172-199717194 TCCACAGTCAGCAAAAAAGGAGG - Intergenic
945219222 2:207467068-207467090 TCCACACAGAGCACAGAGCAAGG + Intergenic
948074550 2:235155813-235155835 TCCTCAGGGAGCACAGACAGTGG - Intergenic
948309253 2:236972707-236972729 TCCTCAGTGACCCCAGAACTTGG - Intergenic
948588166 2:239034324-239034346 TCCACCGTAAGCACAGCACTGGG - Intergenic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
948853784 2:240720821-240720843 GGCACAGAGAGCACAGAACAGGG - Intronic
1169247590 20:4035724-4035746 TCCACAATGAACACATAAGGTGG - Intergenic
1171141848 20:22750202-22750224 TCCATAGGGAGCACAGAAGCGGG - Intergenic
1177192036 21:17862756-17862778 TACACAGTGGGCACAGAGAGAGG + Intergenic
1177310515 21:19386434-19386456 TCCACAGTGAGCCCTTAAAGTGG + Intergenic
1178225255 21:30709532-30709554 TCCACCATTAGCACAGAAGGTGG + Intergenic
1179484053 21:41698272-41698294 TCCAGAGTGAGGACTGACCGTGG - Intergenic
1180944999 22:19687985-19688007 TCCACAGTGTGCACAGGGTGTGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1182357463 22:29728764-29728786 TCCACAGTGTGCACAGCCCTGGG - Intronic
1183770435 22:39920608-39920630 GTCACAGTCAGCACAGAATGGGG - Intronic
1184357709 22:43993620-43993642 TGGACAGTGAGCTCTGAACGGGG + Intronic
1184994881 22:48198351-48198373 ACCACAGCGATGACAGAACGTGG - Intergenic
950357057 3:12420516-12420538 TCCACAGCCAGCTCAGAATGAGG - Intronic
954457657 3:50608570-50608592 TCCACAGCCAGCAAAGGACGAGG + Exonic
954803150 3:53199041-53199063 CCCACAGTGAGCCCAGCACGTGG + Intergenic
957094783 3:75768452-75768474 ACCACAGTGAGAACTGAATGAGG - Intronic
965113093 3:164451883-164451905 ACCACAGTTACCACAGAAAGAGG - Intergenic
967100784 3:186213867-186213889 TCTCCAGGGAGGACAGAACGAGG + Intronic
967176714 3:186867231-186867253 TCCACAATGAACACATAAGGTGG - Intergenic
971173890 4:24262285-24262307 TCCAGAATGAGCACAGGACCCGG - Intergenic
978337084 4:107681197-107681219 CCCACAGTTAGGACAGAATGAGG + Intronic
981751081 4:148092789-148092811 ACCACAGTGAGCAGAGAATGGGG - Intronic
984045351 4:174791053-174791075 TTCACATTGTGCACAGAATGTGG + Intronic
984341274 4:178459773-178459795 TCCACAGTGAGCTGGGAAGGAGG - Intergenic
984413403 4:179426216-179426238 TACAGAGTGAGTACAGAGCGAGG + Intergenic
985528484 5:420178-420200 TCCAGAGTGAACACTGAAGGAGG + Intronic
985777354 5:1851710-1851732 TTCACGGTGAACACAGAAAGGGG + Intergenic
986959285 5:13193424-13193446 TCCAAAGTGAGCAGAGATGGAGG + Intergenic
988077920 5:26376322-26376344 TCCACAGTCACCGCAGAATGGGG + Intergenic
990433677 5:55765475-55765497 TCTACCGTGAGCTCAGAACTTGG - Intronic
992557054 5:77914163-77914185 TCAACACTGAGCACAGCACCTGG + Intergenic
993420909 5:87700218-87700240 TCCAGCATGAGCACAGAACTGGG - Intergenic
993720584 5:91317850-91317872 ACCACAGTGAGCCCAGATCGCGG - Intergenic
1001486124 5:172120681-172120703 TCCACACTGAGAACTGAACATGG - Intronic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002200822 5:177527080-177527102 TCTGCACTGAGCACAGAATGGGG + Intronic
1002571254 5:180140509-180140531 ACCGCAGTGAGCACAGAGAGTGG - Intronic
1002757369 6:174802-174824 TCTACATTGAGCAAAGAAAGTGG + Intergenic
1006449884 6:34099718-34099740 TCCCCAGTGATCAAAGAACAAGG + Intronic
1006782767 6:36643359-36643381 TCCACGGGGAGCACAGAGCTGGG + Intergenic
1006782773 6:36643382-36643404 TCCACGGGGAGCACAGAGCTGGG + Intergenic
1007269672 6:40626950-40626972 TCCTCAGTGAGCACAGAGGCAGG - Intergenic
1007653382 6:43437132-43437154 TCCACAGAGAGAAGAGAACCAGG - Intronic
1010408405 6:75532726-75532748 TTCAGAGTGACCACAGAACCTGG + Intergenic
1012597671 6:101058818-101058840 TACACAGTGTGTACAGAAAGGGG + Intergenic
1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG + Intronic
1014222242 6:118809463-118809485 CCTTGAGTGAGCACAGAACGTGG + Intergenic
1015665863 6:135627989-135628011 ACCACAGTTAGCACAGAATATGG + Intergenic
1018777061 6:167027417-167027439 TCCACAGAGAGCATAGGAAGTGG - Intronic
1019170274 6:170129815-170129837 TGCACGGTGTGCACAGAGCGTGG - Intergenic
1020002862 7:4765549-4765571 TCCCCAGTGACCCCAGAACGGGG - Exonic
1020606326 7:10341860-10341882 TCCACAGTCAGCCCAGGATGGGG + Intergenic
1022071170 7:26915907-26915929 TCCACAGTGAGCAGAAATCGAGG - Intronic
1023379898 7:39596641-39596663 TGCACAGGGAGCACAGAAAATGG - Intronic
1024233628 7:47381361-47381383 GCTACACTGAACACAGAACGTGG - Intronic
1025853805 7:65261890-65261912 TCCACAATGAACACATAAGGTGG - Intergenic
1027891684 7:83985755-83985777 TGCACAGTGAGCACAGTGAGAGG + Intronic
1029700940 7:102246524-102246546 CCCACAGTCAGCACAGGACCCGG + Intronic
1034991214 7:155549139-155549161 CCCACAGTGACCACAGCACAGGG - Intergenic
1035596873 8:865457-865479 TCAACACTGAGAACAGCACGAGG - Intergenic
1035617254 8:1011580-1011602 TACACAGTGAGCCCTGGACGAGG + Intergenic
1035617275 8:1011715-1011737 TACACAGTGAGCCCTGGACGAGG + Intergenic
1035650874 8:1263753-1263775 TCCACAGAGAGCAGAGAACAGGG - Intergenic
1035901439 8:3461839-3461861 TGCACTGTGAGCAGAGACCGAGG + Intronic
1036220055 8:6913974-6913996 ACCACAGTGAGCAGGGAAGGAGG - Intergenic
1037456186 8:19066582-19066604 TCCACAGTCAATACAGAACCTGG + Intronic
1038249397 8:25888925-25888947 CCCACAGTGGGCACTGAAAGGGG - Intronic
1038361529 8:26884255-26884277 TCAATAGTGAGCACAAAACCAGG + Intergenic
1038421692 8:27437812-27437834 TCTGCAGTGAGTACAGCACGAGG - Exonic
1041027572 8:53703012-53703034 ACCACTGTGAGCACAGCATGGGG - Intergenic
1045648807 8:104324348-104324370 CCCACAGTGTCCACAGAAGGGGG + Intergenic
1049323446 8:142009707-142009729 TCCAGACTGAGCTCAGACCGGGG - Intergenic
1049567365 8:143348060-143348082 TCCACTCTTAGCACAGAAGGAGG - Intronic
1052710365 9:32048154-32048176 TCCAAAGTGTACACAGAAAGGGG - Intergenic
1053150192 9:35738362-35738384 TCCACAGTAAGCACTGATCAGGG + Exonic
1061204855 9:129156973-129156995 CCCACAGTGAGCCGAGAAGGTGG + Intergenic
1061489019 9:130934866-130934888 TAAACAGTGAGCTCAGAAGGAGG + Intronic
1061839824 9:133352127-133352149 TCCACAGAGAGCACAGTCCCTGG - Exonic
1185850134 X:3477447-3477469 TCCACAGTGAGGTCAGGAGGAGG + Intergenic
1188574238 X:31627063-31627085 TAAACAGTGAAAACAGAACGTGG - Intronic
1189196737 X:39159933-39159955 TCCCCAGTGAGCACAGGGCCTGG - Intergenic
1193826735 X:86235514-86235536 TCCAAAGTTAGCAGAGAAGGAGG - Intronic
1196665336 X:118309956-118309978 TCAACAGTGAGCACTAAACTTGG + Intergenic
1198968114 X:142249718-142249740 CCCACCCTGAGCACAGAACAGGG - Intergenic