ID: 1014178136

View in Genome Browser
Species Human (GRCh38)
Location 6:118352234-118352256
Sequence ACTAGGAAAATGATTGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014178136_1014178142 17 Left 1014178136 6:118352234-118352256 CCACTAACAATCATTTTCCTAGT No data
Right 1014178142 6:118352274-118352296 TCTGATCACCAGAGTTGATGTGG No data
1014178136_1014178144 26 Left 1014178136 6:118352234-118352256 CCACTAACAATCATTTTCCTAGT No data
Right 1014178144 6:118352283-118352305 CAGAGTTGATGTGGTCTGTGTGG No data
1014178136_1014178137 -7 Left 1014178136 6:118352234-118352256 CCACTAACAATCATTTTCCTAGT No data
Right 1014178137 6:118352250-118352272 TCCTAGTAGACTACCCAAAATGG No data
1014178136_1014178139 -6 Left 1014178136 6:118352234-118352256 CCACTAACAATCATTTTCCTAGT No data
Right 1014178139 6:118352251-118352273 CCTAGTAGACTACCCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014178136 Original CRISPR ACTAGGAAAATGATTGTTAG TGG (reversed) Intergenic
No off target data available for this crispr