ID: 1014186454

View in Genome Browser
Species Human (GRCh38)
Location 6:118439820-118439842
Sequence GCCTTGGATGCCTGTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014186451_1014186454 -7 Left 1014186451 6:118439804-118439826 CCCATTTGCTCATTTTGCCTTGG No data
Right 1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG No data
1014186453_1014186454 -8 Left 1014186453 6:118439805-118439827 CCATTTGCTCATTTTGCCTTGGA No data
Right 1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG No data
1014186450_1014186454 28 Left 1014186450 6:118439769-118439791 CCTTTGCTGTGTGGAAGCTTTTA No data
Right 1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014186454 Original CRISPR GCCTTGGATGCCTGTGTCTG TGG Intergenic
No off target data available for this crispr