ID: 1014186966

View in Genome Browser
Species Human (GRCh38)
Location 6:118445754-118445776
Sequence GTTCATGCCCAGGGGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014186955_1014186966 17 Left 1014186955 6:118445714-118445736 CCCCAAAAAATATTCTGGCAGTG No data
Right 1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG No data
1014186956_1014186966 16 Left 1014186956 6:118445715-118445737 CCCAAAAAATATTCTGGCAGTGT No data
Right 1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG No data
1014186957_1014186966 15 Left 1014186957 6:118445716-118445738 CCAAAAAATATTCTGGCAGTGTG No data
Right 1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG No data
1014186954_1014186966 18 Left 1014186954 6:118445713-118445735 CCCCCAAAAAATATTCTGGCAGT No data
Right 1014186966 6:118445754-118445776 GTTCATGCCCAGGGGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014186966 Original CRISPR GTTCATGCCCAGGGGCCTGT GGG Intergenic
No off target data available for this crispr