ID: 1014187974

View in Genome Browser
Species Human (GRCh38)
Location 6:118457588-118457610
Sequence AACAGAAGGCGGGTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014187974_1014187986 15 Left 1014187974 6:118457588-118457610 CCCACCCCCACCCGCCTTCTGTT No data
Right 1014187986 6:118457626-118457648 GGGGTCTTGTGATGTTGCCCAGG 0: 7
1: 281
2: 3981
3: 18687
4: 65738
1014187974_1014187984 -5 Left 1014187974 6:118457588-118457610 CCCACCCCCACCCGCCTTCTGTT No data
Right 1014187984 6:118457606-118457628 CTGTTTTTGTTTTTTGAGATGGG 0: 7
1: 71
2: 759
3: 6785
4: 28753
1014187974_1014187985 -4 Left 1014187974 6:118457588-118457610 CCCACCCCCACCCGCCTTCTGTT No data
Right 1014187985 6:118457607-118457629 TGTTTTTGTTTTTTGAGATGGGG 0: 28
1: 106
2: 2545
3: 7506
4: 34105
1014187974_1014187983 -6 Left 1014187974 6:118457588-118457610 CCCACCCCCACCCGCCTTCTGTT No data
Right 1014187983 6:118457605-118457627 TCTGTTTTTGTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014187974 Original CRISPR AACAGAAGGCGGGTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr