ID: 1014189483

View in Genome Browser
Species Human (GRCh38)
Location 6:118476580-118476602
Sequence CAGTAGAAATAGTGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014189483_1014189488 23 Left 1014189483 6:118476580-118476602 CCATTTTCCCACTATTTCTACTG 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1014189488 6:118476626-118476648 TTATGAGATTTGCTAAAAATTGG No data
1014189483_1014189487 -2 Left 1014189483 6:118476580-118476602 CCATTTTCCCACTATTTCTACTG 0: 1
1: 0
2: 2
3: 35
4: 414
Right 1014189487 6:118476601-118476623 TGAGGAAAACTGCTAGATGAAGG 0: 1
1: 0
2: 1
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014189483 Original CRISPR CAGTAGAAATAGTGGGAAAA TGG (reversed) Intronic
902695542 1:18138403-18138425 CAGTAGCAGTAGTAGGAATACGG - Intronic
902717100 1:18280341-18280363 CAGTAGAACTAGTGGCAATTGGG - Intronic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
905501199 1:38439211-38439233 CAGTACAAAGAATGGGAAGAAGG - Intergenic
906492215 1:46277636-46277658 CAGGAGACAGACTGGGAAAATGG + Exonic
906737084 1:48140740-48140762 GAGTAGACAGAGTAGGAAAAAGG + Intergenic
906781080 1:48573282-48573304 CAGTAGGGAGAGTGGGAAACTGG + Intronic
906817526 1:48894116-48894138 CAGTAGAATTACTGGGTCAAAGG - Intronic
908731395 1:67229971-67229993 CAGTAGAAAGCCTGGCAAAATGG + Intronic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909308501 1:74114332-74114354 TAGTACAAAAAGTGGGGAAAGGG + Intronic
909421800 1:75475587-75475609 CAGTTAAAATAGTGGGAAATGGG - Intronic
910044874 1:82901474-82901496 CAGCAAAAATAAGGGGAAAATGG - Intergenic
911414837 1:97558159-97558181 CACTAGAAAGGGGGGGAAAAAGG - Intronic
912687052 1:111775968-111775990 AGGCAGAAATAGTGGGGAAAGGG + Exonic
913414554 1:118590487-118590509 CCATAGAAAGAGTGGGGAAAAGG + Intergenic
913681682 1:121191815-121191837 CAGAAGAAATAGTCTGAAACAGG + Intronic
914033517 1:143979444-143979466 CAGAAGAAATAGTCTGAAACAGG + Intergenic
914155930 1:145088526-145088548 CAGAAGAAATAGTCTGAAACAGG - Intronic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
916306994 1:163347438-163347460 TAGTACAAATAAAGGGAAAAGGG - Intronic
916690591 1:167186411-167186433 CAATAGAGATAGTGGCAAACTGG - Intergenic
916707860 1:167371620-167371642 CTCTAGAAATAGGGGGTAAAGGG - Intronic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917390577 1:174531859-174531881 CAATAGAAATACTGGAAGAAAGG + Intronic
917975839 1:180237107-180237129 CAGAAGAAATTGGGGGAACAGGG - Intronic
918487286 1:185043492-185043514 CAGGAGAATTAGTGGAAAAACGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918797552 1:188922186-188922208 CAGTAGAAACAGAGTGTAAAAGG - Intergenic
920468997 1:206210323-206210345 CAGAAGAAATAGTCTGAAACAGG + Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG + Intergenic
922139211 1:222865278-222865300 GAGTAGGAAAAGTTGGAAAAGGG + Intergenic
922179007 1:223219131-223219153 TAGTCGAAACAATGGGAAAAAGG + Intergenic
922637910 1:227194754-227194776 AACTAGACATAGTGGAAAAATGG + Intronic
922667180 1:227480529-227480551 GAGTTGGCATAGTGGGAAAAAGG + Intergenic
923309016 1:232717089-232717111 TAATAGAAATACTAGGAAAAGGG - Intergenic
923592135 1:235328357-235328379 CCATAGAACTGGTGGGAAAATGG - Intronic
924136127 1:240968787-240968809 CAGTACAAAAAGTGTGATAAGGG - Intronic
924579608 1:245312522-245312544 CATTAGCAATGGTAGGAAAATGG + Intronic
1064705515 10:18069177-18069199 CAGAAGAAATAGCGGTGAAAAGG + Intergenic
1065552198 10:26879201-26879223 CTCTGGAAACAGTGGGAAAAGGG - Intergenic
1066155920 10:32677800-32677822 AAGAAGAAAGAGAGGGAAAATGG - Intronic
1067332767 10:45337404-45337426 GAGCTGAAATTGTGGGAAAATGG + Intergenic
1067475098 10:46559535-46559557 CAGAAAAGATAGTGGGAAACTGG + Intergenic
1068555335 10:58452605-58452627 CAGTTGCAATACTGGGAAGAGGG + Intergenic
1068768581 10:60794957-60794979 GAGGAGATATAGTTGGAAAAAGG - Intergenic
1068933325 10:62613153-62613175 AAGTAGAAATTCTGGGCAAAAGG - Intronic
1069448772 10:68499092-68499114 GAGGAGAAAGAATGGGAAAAAGG + Intronic
1070869477 10:79737810-79737832 CATTAGAAAAAATGGGAAAAGGG - Intergenic
1071033342 10:81211849-81211871 CAGAAGAAAAAATGGGCAAACGG + Intergenic
1071228858 10:83562846-83562868 CAGAAGATATGATGGGAAAAGGG + Intergenic
1071415472 10:85437235-85437257 CAGGTGAGATAGTGGGAGAAGGG - Intergenic
1071636399 10:87260017-87260039 CATTAGAAAAAATGGGAAAAGGG - Intergenic
1071658844 10:87477921-87477943 CATTAGAAAAAATGGGAAAAGGG + Intergenic
1072973098 10:100034449-100034471 CAGGAAAAATGGGGGGAAAAAGG - Intergenic
1073757037 10:106591978-106592000 CAATACAAAGAGTTGGAAAAGGG - Intronic
1074461916 10:113646140-113646162 AAGTATAAAAAGTGTGAAAAGGG - Intronic
1074617622 10:115085573-115085595 CAGGAGAGAGAGTGAGAAAAAGG - Intergenic
1074688927 10:115985970-115985992 CAGTAGAAAGAGGTGGCAAAAGG + Intergenic
1074909866 10:117898521-117898543 CATTACAAATAGTGAGAAAAAGG - Intergenic
1075898715 10:126020688-126020710 TAGTAGAAATAGAAGAAAAACGG + Intronic
1076157968 10:128218019-128218041 AAGTAGAATTACTTGGAAAATGG + Intergenic
1076318355 10:129559494-129559516 CATTAAAAAAAATGGGAAAATGG - Intronic
1077777824 11:5291272-5291294 CAGGAGATATATTAGGAAAAAGG + Intronic
1078127592 11:8583318-8583340 TAGTAGAAATATTGGCAAATTGG - Intronic
1079363852 11:19792267-19792289 CAGAAGAAATTATGGGAGAAGGG - Intronic
1079563433 11:21851218-21851240 CAACAGAGATAGTGAGAAAAGGG + Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080120253 11:28668553-28668575 CAGGAGAAATAGGAGGAAATAGG - Intergenic
1080274007 11:30483175-30483197 CAGTAGAATAAGTAGAAAAATGG - Intronic
1081420489 11:42870484-42870506 AAATAGAAATCCTGGGAAAAGGG + Intergenic
1084776359 11:71379415-71379437 CAGTAGAAGAGGTGGTAAAAGGG - Intergenic
1084994436 11:72961868-72961890 GAGTTGAAATAGAGTGAAAAGGG - Intronic
1085963276 11:81489154-81489176 CAGAAGAAATAGTGTGTAGAAGG - Intergenic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086575864 11:88338289-88338311 AAGTAGGAAGAGTTGGAAAACGG - Intergenic
1086992501 11:93319453-93319475 CTGTTCAAATAGTGGAAAAATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088977751 11:114830817-114830839 TAGTAGAAATAGAGAGGAAATGG + Intergenic
1090303224 11:125666144-125666166 CAGCAAAAATAGTGCTAAAAAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1092469130 12:8762679-8762701 CACTAGAATTAGAAGGAAAAAGG - Intronic
1092563024 12:9636699-9636721 AAGAAAAAAAAGTGGGAAAAAGG + Intergenic
1093340065 12:17963181-17963203 AAGAAGAAATATTGTGAAAATGG - Intergenic
1093349452 12:18079932-18079954 ACGTAAAAGTAGTGGGAAAACGG - Intergenic
1093641291 12:21529351-21529373 GCTTAGATATAGTGGGAAAAGGG + Intronic
1093672433 12:21893168-21893190 AAGTAAAAATGGTGGAAAAATGG + Intronic
1094337379 12:29375245-29375267 AATTAGAAATAGTGTGATAAAGG - Intronic
1095083115 12:38030229-38030251 CACTAGAATTAGAAGGAAAAAGG - Intergenic
1098041611 12:66358807-66358829 GAGGAGAAATAGTGAGAGAAGGG + Intronic
1098176426 12:67796833-67796855 CAGTCGCAAATGTGGGAAAAGGG - Intergenic
1098717125 12:73843968-73843990 CTGGAGAAGTAGTGGGAATAGGG - Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100615350 12:96227331-96227353 CAGAAGAGATGATGGGAAAAAGG - Intronic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1101583242 12:106062747-106062769 CACAAGAAACAGTGGCAAAATGG + Intergenic
1102059094 12:109919004-109919026 CAGTAGAAATAGTAAGACAGTGG - Intronic
1104218277 12:126756302-126756324 AAGCAGAAATAGTTGGAAAATGG + Intergenic
1105641027 13:22264349-22264371 CAGTACAAATAGTGCAAATAAGG + Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1107320876 13:39186679-39186701 CAGTGGAATTACTGGGAAATTGG + Intergenic
1108162446 13:47655977-47655999 CATTACAAAGAGTGAGAAAATGG - Intergenic
1108277819 13:48828901-48828923 CAGTAGAAAGAGCTAGAAAAGGG - Intergenic
1108474813 13:50804089-50804111 CATTTCAATTAGTGGGAAAAGGG - Intronic
1108823580 13:54383821-54383843 CAGTAGGTATAGTAAGAAAATGG + Intergenic
1109147343 13:58796137-58796159 CAGTAGAAAATATGGGAAATAGG + Intergenic
1110420290 13:75299881-75299903 CAGGAGAAATACCAGGAAAATGG + Intronic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111227291 13:85290415-85290437 CAGTACAAATATTGGAAAGAGGG - Intergenic
1111408253 13:87838613-87838635 CAAAACAAATAGTGGGATAATGG + Intergenic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112898678 13:104333601-104333623 CACTAAAAATATTAGGAAAAAGG - Intergenic
1113680149 13:112238272-112238294 CAGGAGCAAGAGTGAGAAAAGGG + Intergenic
1114363517 14:22002460-22002482 CAGAAAATATGGTGGGAAAAAGG + Intergenic
1114864100 14:26566762-26566784 CAATAAAAATTGTGGAAAAACGG + Intronic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116314291 14:43367614-43367636 CAGTGGAAAAACTGGGTAAACGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116731532 14:48628654-48628676 AAAAAGAAATAGGGGGAAAAAGG - Intergenic
1117835366 14:59799655-59799677 CACAAGAAATATTTGGAAAAGGG + Intronic
1118515479 14:66523862-66523884 AAGATAAAATAGTGGGAAAAGGG - Intronic
1119742298 14:77021989-77022011 CAGAAGAAATGGAGGTAAAATGG + Intergenic
1120631718 14:86899820-86899842 CAGAAGAACTAGTGGGGCAAAGG + Intergenic
1120764094 14:88312515-88312537 CAGTAGAAATGCTGGGGAATGGG - Intronic
1122053483 14:99075998-99076020 CAGAAGGGAGAGTGGGAAAAGGG - Intergenic
1122104012 14:99437392-99437414 CAGCAGAAAGAGTGGGAGTAGGG - Intronic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124162127 15:27281823-27281845 CAGTAGAAAGAGTGAAAATATGG - Intronic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124796525 15:32786470-32786492 CAGAAGAAAAAGTCAGAAAAGGG + Intronic
1125800472 15:42442284-42442306 CTCCAGAAAAAGTGGGAAAAAGG + Exonic
1126852921 15:52809099-52809121 TAGAAAAAATAATGGGAAAAGGG + Intergenic
1127839065 15:62814207-62814229 CTGGAGAAATAATGGAAAAAAGG + Intronic
1128024406 15:64422816-64422838 CTGAAGAATTACTGGGAAAATGG - Intronic
1128170854 15:65511081-65511103 GAGTGGAAGTACTGGGAAAAAGG - Intronic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1130473284 15:84241935-84241957 CAGTTTAAATGCTGGGAAAAAGG + Intronic
1130480699 15:84355999-84356021 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130484897 15:84393426-84393448 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130491013 15:84431760-84431782 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130502597 15:84510559-84510581 CAGTTTAAATGCTGGGAAAAAGG - Intergenic
1130595570 15:85246530-85246552 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1130879623 15:88043939-88043961 ACTTAGAAATACTGGGAAAAGGG - Intronic
1131282622 15:91033506-91033528 CAGTTTAAATGGTGAGAAAAGGG - Intergenic
1131671830 15:94627938-94627960 CAGAAGAAAGAGGGAGAAAACGG - Intergenic
1133587785 16:7212410-7212432 CATTTAAAATAGTGGGAAAGAGG - Intronic
1134205706 16:12236486-12236508 GAGAAGACGTAGTGGGAAAAGGG - Intronic
1135165128 16:20132346-20132368 CAGTAGAAATATCTGGAACAAGG + Intergenic
1135281046 16:21153847-21153869 GAGTAGAAAAAGGGGGAAAATGG - Intronic
1136931268 16:34419883-34419905 CAGGAAAATTAGTGGCAAAATGG + Intergenic
1136973305 16:34991936-34991958 CAGGAAAATTAGTGGCAAAATGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1141080393 16:81046215-81046237 CAAGAAAAAAAGTGGGAAAAGGG + Exonic
1142827038 17:2519898-2519920 CAGTAGAAATTGTGGGAAGGAGG - Intergenic
1143231994 17:5364231-5364253 CAGAAAAAGAAGTGGGAAAAGGG + Intronic
1150077506 17:62205302-62205324 CATTAGAAATGGTTGCAAAATGG + Intergenic
1151470275 17:74313771-74313793 GATTAGAAATAGTGGGCATAAGG - Intronic
1151865572 17:76799867-76799889 CAGGAGAAATCATGGGGAAAGGG - Intergenic
1153082149 18:1239793-1239815 TAGAAGAAATGGTGAGAAAAAGG - Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153440963 18:5118465-5118487 CAGGAGAGAGAGTGTGAAAAGGG - Intergenic
1153491128 18:5648887-5648909 CAGTAGAAATAATGGACAGAAGG + Intergenic
1153621125 18:6979051-6979073 CAGCAGAAAAAGCTGGAAAAAGG + Intronic
1153623423 18:7001311-7001333 CATGAGGAATAGGGGGAAAACGG - Intronic
1153765577 18:8371731-8371753 CAGCAGAAAGAGGGGGAATAAGG - Intronic
1154102512 18:11489296-11489318 AAACAGAAATAGGGGGAAAATGG + Intergenic
1154529324 18:15329105-15329127 CAGTAGAAATGGTGTGAACCTGG - Intergenic
1155015425 18:21834026-21834048 CCGTAGAGTTACTGGGAAAAAGG - Intronic
1155688977 18:28592949-28592971 TAGTAGAGATAGTGGGGAGAGGG + Intergenic
1155869146 18:31004182-31004204 CAGGAGTAATACTTGGAAAATGG - Exonic
1155895528 18:31321057-31321079 CCATAGAAAGAGGGGGAAAATGG - Intronic
1156505122 18:37585707-37585729 TAGTGGAAAAAGTAGGAAAAAGG + Intergenic
1156586587 18:38437802-38437824 CAGTAGAAATAGCCAGAAACAGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157015637 18:43709382-43709404 CAGTAGAAGAGGGGGGAAAATGG + Intergenic
1157048284 18:44129547-44129569 CAGTTGAGAGAGTAGGAAAAGGG - Intergenic
1157434103 18:47654009-47654031 CAGAAGAAATACTGGCAAAATGG + Intergenic
1157740749 18:50090581-50090603 CAGTAGAAATAGGAGCAGAAAGG - Intronic
1158891482 18:61876026-61876048 GAGTAGGAATAGTATGAAAAAGG - Intronic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1159126058 18:64226083-64226105 AAGTAGAAATAGAAAGAAAACGG + Intergenic
1163748085 19:19059865-19059887 CAGTGGAAAGACTGGGAAATGGG - Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1167117540 19:47496979-47497001 CAGTGGAAACGGTGGCAAAAAGG + Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
925623880 2:5822457-5822479 AAGTAGTAAGAGTGGGAAAAAGG - Intergenic
926587526 2:14704689-14704711 CATTAGAAATAGTTGGAATATGG + Intergenic
927784097 2:25960453-25960475 CATGAGAAATAGTAGGAATATGG - Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
929679222 2:43972310-43972332 CAGTTGAAATAGTAGAAAATGGG - Intronic
929749759 2:44697935-44697957 AAGCAGAAATACTGGGGAAAGGG + Intronic
930300127 2:49605042-49605064 TAGTCGAGAAAGTGGGAAAAGGG + Intergenic
933820193 2:86104253-86104275 CAGTAGCAATTGGGAGAAAAAGG + Intronic
933915130 2:86983210-86983232 CATTAGCAAAAGTGCGAAAATGG - Intronic
934007864 2:87786690-87786712 CATTAGCAAAAGTGCGAAAATGG + Intronic
934725391 2:96613873-96613895 AAGTAGAAACATTTGGAAAAGGG - Intronic
935771503 2:106427608-106427630 CATTAGCAAAAGTGCGAAAATGG + Intronic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
935908570 2:107868339-107868361 CATTAGCAAAAGTGCGAAAATGG - Intronic
936130357 2:109833463-109833485 CATTAGCAAAAGTGCGAAAATGG - Intronic
936142561 2:109952854-109952876 TAGAAGAAATACTAGGAAAATGG + Intergenic
936179249 2:110250819-110250841 TAGAAGAAATACTAGGAAAATGG + Intergenic
936202127 2:110418613-110418635 TAGAAGAAATACTAGGAAAATGG - Intronic
936214340 2:110538022-110538044 CATTAGCAAAAGTGCGAAAATGG + Intronic
936423476 2:112392585-112392607 CATTAGCAAAAGTGCGAAAATGG + Intronic
937315010 2:120926537-120926559 AAGTAGTTATACTGGGAAAAGGG - Intronic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
938768219 2:134478063-134478085 CAGTAGCAAGAGTGGGAACAAGG - Intronic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
940477162 2:154177653-154177675 CAGTAGGAATAGTGGGCTAGGGG + Intronic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
941467872 2:165851965-165851987 CAGTAAAAATAGATAGAAAAAGG - Intergenic
943346680 2:186746507-186746529 CAGTAGAAATAATTGAAAACTGG + Intronic
943793000 2:191955939-191955961 CAGGAGAAAGAGTGGTAATATGG + Intronic
943917679 2:193657706-193657728 TAGAACAAATAGTGGGAAACAGG + Intergenic
946266562 2:218548187-218548209 GGGAAGAATTAGTGGGAAAAGGG - Intronic
946281099 2:218666013-218666035 CAGTGGAAGTAGTGGTAACAGGG + Exonic
946545450 2:220737060-220737082 CAAAAGAAAAAGGGGGAAAATGG + Intergenic
946605231 2:221396980-221397002 GAGTACAAATGGTGGAAAAATGG + Intergenic
948178556 2:235962358-235962380 CAGGAGAGATGGTGGGAGAAGGG + Intronic
948226327 2:236311903-236311925 GAGAAGAAATAGGAGGAAAAGGG - Intergenic
1169677335 20:8168808-8168830 CTGTAAAAACACTGGGAAAATGG + Intronic
1170921293 20:20682181-20682203 CAGTAAATATAGTGTGAAATTGG - Intronic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172786683 20:37473291-37473313 CCGTAGAAATAGTGGGCAGGTGG - Intergenic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1174259635 20:49284528-49284550 CAGGGGAAATAGTAAGAAAAAGG - Intergenic
1174345633 20:49927489-49927511 CATGGGAAATAGTTGGAAAATGG + Intergenic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1177169049 21:17635646-17635668 GAGTAGAATTAGTGGATAAAAGG - Intergenic
1178736463 21:35157038-35157060 CATAATGAATAGTGGGAAAAGGG - Intronic
1181138789 22:20788340-20788362 CAGTAAGAAGAGTGGTAAAAGGG + Intronic
1181328382 22:22069309-22069331 CAGCAGAAAAAGTGACAAAATGG + Intergenic
1183329592 22:37212167-37212189 CAATAGAAATAGAGGGGAAAGGG + Exonic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
949687983 3:6600036-6600058 CAATAGAAATACATGGAAAAAGG + Intergenic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
949867188 3:8555650-8555672 TAGTATAAAAAGTGGGAGAAAGG - Intronic
950164417 3:10783119-10783141 AAGTTGAAATAGTTTGAAAAGGG + Intergenic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952655057 3:35776293-35776315 CATTAGAAACACTGGGAAAGTGG + Intronic
953190977 3:40687948-40687970 CAGTAGAACTAGTGTGGGAATGG + Intergenic
953849418 3:46454757-46454779 CAGCAGACAGAATGGGAAAAGGG + Intronic
954843069 3:53530273-53530295 CAGGAAAAATACAGGGAAAAAGG + Intronic
955559415 3:60172624-60172646 CAGAAAAAATGTTGGGAAAACGG + Intronic
955844663 3:63149630-63149652 CAGTAGAAATAGTAGGAATTAGG + Intergenic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
956268052 3:67420131-67420153 CAGGAGAAAAATGGGGAAAATGG + Intronic
956539520 3:70320226-70320248 GAGAAGAAGCAGTGGGAAAAGGG + Intergenic
957756322 3:84492774-84492796 AAGTAGAAAAAGAGGGAACATGG + Intergenic
958073542 3:88646833-88646855 AAGGAGAAATAAGGGGAAAAAGG - Intergenic
958158612 3:89787806-89787828 CATTATAAATAATGGGAACAGGG + Intergenic
959168430 3:102812068-102812090 AAATAGAAATAGTGGAAAATGGG - Intergenic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
959357481 3:105351113-105351135 CAGTGGAAGAAATGGGAAAAGGG + Intergenic
959474923 3:106798501-106798523 TAAAAGAAACAGTGGGAAAAAGG + Intergenic
960017631 3:112910633-112910655 CAGCAAAAATAGTGGTAAAAGGG + Intergenic
960163089 3:114371690-114371712 CAGCATAAATGGTGGGAGAAAGG + Intronic
960192153 3:114719459-114719481 CACTAGAAATAATGGGATGAAGG + Intronic
961075640 3:123979435-123979457 CAGTAAAAATAGCCTGAAAATGG + Intronic
961308045 3:125973073-125973095 CAGTAAAAATAGCCTGAAAATGG - Intronic
961753065 3:129108691-129108713 CAGTTGAAATAGGGCTAAAAGGG - Intronic
962005288 3:131343415-131343437 CAGTTTGAATACTGGGAAAATGG + Intronic
962144817 3:132829724-132829746 AAGGATAAATAGTTGGAAAATGG - Intergenic
962297877 3:134209432-134209454 CATTAGGAATAGTGCTAAAATGG - Intronic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963189496 3:142453714-142453736 CAGGAGAAATAGTTGGGAAAAGG - Intronic
963950000 3:151189140-151189162 CAATAGAAAGAGGGAGAAAAAGG + Intronic
965821277 3:172686793-172686815 CAATAGGAAAAGTGAGAAAACGG - Intronic
966168249 3:177046709-177046731 CAATAAAAAAAGTGGCAAAAGGG - Intronic
967642276 3:191879593-191879615 CAGTAGAGAAATTGGGGAAATGG - Intergenic
967760282 3:193216449-193216471 CAGAAGAAAACGTAGGAAAAAGG + Intergenic
967983548 3:195079409-195079431 CTGAAGAAATACAGGGAAAACGG + Intronic
969534622 4:7748132-7748154 CATTAGGAAAAGTGAGAAAATGG + Intergenic
970578338 4:17449499-17449521 GGCTAGGAATAGTGGGAAAATGG + Intergenic
970813429 4:20124428-20124450 CAGTGGATATAGTTAGAAAAGGG - Intergenic
974658589 4:64857830-64857852 CAGGAGAACTAGTACGAAAAAGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975375848 4:73645073-73645095 AAGTAGAAATTTTGTGAAAAGGG - Intergenic
975989110 4:80238473-80238495 CATTAGAAATAGTGACAAATAGG + Intergenic
976018709 4:80593053-80593075 CAGACAAAATAGTGGGAAAAAGG - Intronic
976533584 4:86184999-86185021 GAGGAGAAATAATGGGAAAGGGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977196531 4:94068420-94068442 CAATATAAAAACTGGGAAAATGG - Intergenic
977242246 4:94586920-94586942 CATAAGAAATAGAAGGAAAAAGG - Intronic
977343237 4:95787134-95787156 CAGGAGAAATTCTGGAAAAACGG - Intergenic
977599713 4:98923150-98923172 CCATAGAAACAGTAGGAAAATGG - Intronic
978896290 4:113892029-113892051 TAGTAGAAATAATGGTCAAAAGG + Intergenic
979308717 4:119177145-119177167 AGGTAGAAATAGTGAGCAAAGGG - Intronic
979366527 4:119831144-119831166 CAGTAGTAATAGTGGATCAAAGG + Intergenic
980327744 4:131370161-131370183 AAGTAAAATTAATGGGAAAATGG - Intergenic
980788691 4:137589439-137589461 CAGGTCAAATACTGGGAAAAAGG - Intergenic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
983010541 4:162540241-162540263 CAGGAGAAAGAGAGAGAAAAGGG + Intergenic
983756252 4:171340751-171340773 AAGTAGAAAGAGTGGGAAAATGG - Intergenic
986228494 5:5839544-5839566 CACTACAAATAGAAGGAAAAGGG + Intergenic
986757371 5:10850858-10850880 CAGAAGAAACAGTCGGGAAATGG - Intergenic
987301972 5:16605421-16605443 CACTAGAATTTGTGGGGAAAGGG - Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
992319898 5:75603481-75603503 CAGTGGAATGAGTAGGAAAAGGG + Intergenic
993289332 5:86044189-86044211 CAGCAGAAATAGTGAAAATATGG - Intergenic
993915056 5:93734370-93734392 CATTTGAAAAAGTGGCAAAAGGG + Intronic
994413795 5:99442521-99442543 CAGTAGTAATATTGGGAGGATGG - Intergenic
994785492 5:104156206-104156228 AAGTAGAAGTAGTGGCATAATGG - Intergenic
995077492 5:108003878-108003900 GAATAGAGATAATGGGAAAAAGG + Intronic
995792868 5:115911476-115911498 AAGTAAAAATAGTGGCAAATTGG + Intronic
996691863 5:126348619-126348641 CAGTAGAAAGAGTTGAAATAGGG - Intergenic
996794287 5:127327588-127327610 GAGTAGGCATAGTGGAAAAAGGG + Intronic
996941430 5:129010376-129010398 CAGTAGAAACATTGGCAAAAGGG + Intronic
999446296 5:151642639-151642661 CAGGAGAAAGAGAGGGCAAAGGG + Intergenic
999687528 5:154116434-154116456 AAGTAAAAATAAAGGGAAAAAGG - Intronic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000681858 5:164194937-164194959 CAGAATAAATAGGGGGAAACTGG - Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000824450 5:166027452-166027474 CAGTAGAATTACTGAGTAAAAGG - Intergenic
1000881799 5:166706399-166706421 CAGGAGAAATAGTGAGGAAGGGG + Intergenic
1000986996 5:167871764-167871786 CAGTACATAAAGTGGGAACAAGG + Intronic
1002669481 5:180854951-180854973 CAGCTGAAAAAGTTGGAAAATGG + Intronic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1004236925 6:13882472-13882494 CACTAGAATTAGAAGGAAAAAGG + Intergenic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1007597871 6:43062736-43062758 CAGTGGAGGTAGTGGGAAATTGG + Intronic
1008607362 6:53153156-53153178 CAGTAGAAGAACTGGGCAAATGG - Intergenic
1008829941 6:55746918-55746940 GAGTAGAAAAAGTTGGAGAAGGG + Intergenic
1009405621 6:63308764-63308786 TGTTAGAAATAGTGGAAAAAGGG + Intronic
1010015154 6:71096518-71096540 CAGAAGATAAAGCGGGAAAAGGG - Intergenic
1010722689 6:79301728-79301750 CAGTGGCAAAAATGGGAAAAAGG - Intergenic
1011535956 6:88376360-88376382 CAGTAGAAAAAGTGAGTGAAAGG + Intergenic
1013817218 6:114112856-114112878 CAATAGAAACATTAGGAAAATGG - Intronic
1013904562 6:115199597-115199619 TAGGAGAGATAGTGGGAGAAAGG + Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1014706133 6:124749843-124749865 AAGGGGAAATAGTGGGAAATGGG - Intronic
1014914957 6:127135488-127135510 CAGTAGTAGTAGTAGGAAATGGG + Intronic
1015184518 6:130399355-130399377 CAGTAGAAAGGATGGGAAACAGG - Intronic
1015827931 6:137335536-137335558 CAGTAGAATTATGGGGGAAAAGG - Intergenic
1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG + Intergenic
1016342919 6:143082156-143082178 CACTAGAATTAGAAGGAAAAAGG - Intronic
1016839001 6:148507168-148507190 CAGAAGACAGAGTGGGAGAAGGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1018687633 6:166316241-166316263 CACTAGAATTAGAAGGAAAAAGG + Intergenic
1018691301 6:166346239-166346261 CACTAGAATTAGAAGGAAAAAGG - Intergenic
1020341861 7:7119992-7120014 TAGTAGATAGAGTGGGAAATGGG - Intergenic
1020456808 7:8382982-8383004 CATTAGAAATATTGAGAAATGGG - Intergenic
1020704459 7:11526696-11526718 CAGGAGAAAGAGAGGGGAAAGGG - Intronic
1021371612 7:19855630-19855652 AAGTAAAAATAATAGGAAAAAGG - Intergenic
1021385803 7:20028296-20028318 CAGGAGAGAGAGAGGGAAAAGGG - Intergenic
1023687623 7:42752595-42752617 CTGCAAAAAGAGTGGGAAAATGG - Intergenic
1023703332 7:42913553-42913575 AAGTAGAAATAGATGAAAAATGG + Intronic
1023959946 7:44917993-44918015 CAGTAAAAATAGTAAGGAAAGGG + Intergenic
1024169985 7:46774886-46774908 CAGTAGAAAGAGTAGCACAAAGG - Intergenic
1024713433 7:52044893-52044915 CAATTTAAAAAGTGGGAAAATGG + Intergenic
1026941744 7:74291020-74291042 CAGGAGAAATAGCGTGAATAAGG + Intronic
1028977365 7:96929059-96929081 TAGTAGAAATAATGGAATAATGG + Intergenic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1030137155 7:106265413-106265435 CCATAGAAATAGGGGAAAAAAGG - Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1031067103 7:117116802-117116824 CATTAGAAATACTGGGTAGAAGG + Intronic
1031542733 7:123014865-123014887 CAGTTGAGATAGTAAGAAAAAGG + Intergenic
1031832860 7:126648861-126648883 CAGTAAATATGGTGGGAATATGG - Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033279703 7:139996878-139996900 CAGTAGTCAGAATGGGAAAAGGG - Intronic
1034006819 7:147482227-147482249 CAGAAGAAATAATAGGAAAGGGG + Intronic
1034141988 7:148828665-148828687 CAGTAGAAAGAGTAGAAATAGGG - Intronic
1035838101 8:2778373-2778395 CAATAAAAAGTGTGGGAAAATGG + Intergenic
1035972798 8:4270288-4270310 CAGTATAAAGACTGGGAAGAAGG - Intronic
1037521564 8:19684948-19684970 CAGTAGAAAGTGTGGGAACAGGG - Intronic
1037708689 8:21337986-21338008 CAGTAGCAAAAGTAGGAAATGGG + Intergenic
1037974069 8:23197085-23197107 CAGCAGAAATGGTGGGAATAGGG - Intronic
1038368852 8:26967431-26967453 TAGAAGAGATACTGGGAAAAAGG - Intergenic
1039703687 8:39986384-39986406 CAGTAGAAAAACTGGGCAGATGG + Intronic
1039741563 8:40387759-40387781 AAGTTCAAATACTGGGAAAATGG - Intergenic
1040079430 8:43272338-43272360 CAGAAGAAAGAGTGAGAAGAAGG + Intergenic
1040910746 8:52516215-52516237 AAGGAGACATAGTCGGAAAAGGG - Intergenic
1041709676 8:60882459-60882481 CAGTAGAAAAATGGGCAAAAGGG - Intergenic
1042974214 8:74447356-74447378 CAGTAGAAAAAATGGAAAAATGG - Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043616857 8:82136100-82136122 CAGTAGAGATAATGTGCAAAGGG + Intergenic
1043625258 8:82249203-82249225 CAGTAGAATCAGTGAGAAATAGG + Intergenic
1044504325 8:93000671-93000693 TAATATAAATTGTGGGAAAAGGG + Intronic
1044525906 8:93250861-93250883 CAGAACCAAAAGTGGGAAAAAGG + Intergenic
1045011609 8:97963693-97963715 CAATCCAAAGAGTGGGAAAATGG + Intronic
1045262139 8:100585477-100585499 AAGCAGAATTAGAGGGAAAATGG + Intronic
1046222529 8:111234846-111234868 CAGGAAAAAATGTGGGAAAAAGG - Intergenic
1046229694 8:111336843-111336865 AAGCACAAATAGTGGAAAAAAGG - Intergenic
1046428204 8:114084121-114084143 CAAAAGAAATAGGAGGAAAAAGG + Intergenic
1047241940 8:123098796-123098818 GAGTTGAAATAGTGGCATAAAGG + Intronic
1047696109 8:127405280-127405302 CACTAGCAAAAGGGGGAAAAAGG + Intergenic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1048529987 8:135239104-135239126 AAGGAGAAATAAGGGGAAAAAGG + Intergenic
1048692521 8:136983657-136983679 AAGCAGACATAGTGGGAAAACGG - Intergenic
1049634678 8:143681179-143681201 CAAAAGAGATAGTGAGAAAAGGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050140783 9:2513743-2513765 GAGTAGAAATATGAGGAAAAGGG - Intergenic
1051497901 9:17745511-17745533 CAGTAGAAATAGGAGAAATATGG - Intronic
1052232078 9:26165766-26165788 TAGTGGAATTAGTGGAAAAAGGG + Intergenic
1052432465 9:28384527-28384549 TTTTAAAAATAGTGGGAAAAAGG - Intronic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1055680929 9:78714453-78714475 CAGTACAAATAGCATGAAAATGG - Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055836258 9:80446518-80446540 GAGTAGGAATAGTGGGTAAATGG - Intergenic
1058008525 9:99947086-99947108 CAGAAGATATAGTTAGAAAAGGG - Intronic
1060540332 9:124425186-124425208 CAGAAGAAAGAATGAGAAAATGG + Intergenic
1062310962 9:135936916-135936938 CAACACAAATAATGGGAAAAGGG + Intronic
1186750710 X:12619140-12619162 CAACATAAATAGTGGGAGAAGGG - Intronic
1186990662 X:15063644-15063666 CAGCAAAAGTAGGGGGAAAAAGG + Intergenic
1188166633 X:26871338-26871360 CAGTCAAAATAATGGGAAAAAGG - Intergenic
1190396685 X:49992273-49992295 AAGCAGTAATGGTGGGAAAATGG - Intronic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1194071689 X:89331674-89331696 CAGTACAAAAATTGGCAAAAAGG - Intergenic
1194365669 X:93010964-93010986 CAGTAGCAGCAGTGGGAAAATGG + Intergenic
1194493893 X:94585747-94585769 AAGCAGAATTAGTGAGAAAAAGG + Intergenic
1194769648 X:97886049-97886071 AAGGAGAAATAGAGGGGAAAAGG + Intergenic
1194909775 X:99627661-99627683 CAGTAAAAATAGTGCTTAAATGG + Intergenic
1195589173 X:106603938-106603960 CAGTAGATATAATAGGCAAATGG - Intergenic
1196193407 X:112816730-112816752 CAGTAGAAAAAGCCAGAAAATGG - Intronic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196382176 X:115102787-115102809 AAGAAGAAATACTGTGAAAATGG + Intergenic
1197178981 X:123513922-123513944 CATTAAAAATAGTGGGAAGCGGG - Intergenic
1198446927 X:136726638-136726660 CAGTAGAAAATGTGGGAGGAAGG - Intronic
1199227745 X:145397495-145397517 GAATAGAAATAGAGTGAAAAAGG + Intergenic
1199474316 X:148229080-148229102 CAGTAGTAAAGGTGGGACAAAGG - Intergenic
1200366202 X:155667355-155667377 CAGGACAAATAGGGGGAAATTGG + Intronic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic
1200725935 Y:6667403-6667425 CAGTACAAAAATTGGCAAAAAGG - Intergenic
1200876500 Y:8161021-8161043 AACAAGAAATAGTGGGAAAGGGG + Intergenic
1201347024 Y:12995994-12996016 CAGTCCAAATTATGGGAAAATGG + Intergenic
1202367225 Y:24173827-24173849 CAGTTTAAATGCTGGGAAAAAGG + Intergenic
1202503556 Y:25496296-25496318 CAGTTTAAATGCTGGGAAAAAGG - Intergenic