ID: 1014190601

View in Genome Browser
Species Human (GRCh38)
Location 6:118491996-118492018
Sequence TAACTAGGAAGCAAGATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014190601_1014190604 21 Left 1014190601 6:118491996-118492018 CCAGCTATCTTGCTTCCTAGTTA 0: 1
1: 1
2: 1
3: 15
4: 143
Right 1014190604 6:118492040-118492062 TACTTACCTTCTCAAAACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014190601 Original CRISPR TAACTAGGAAGCAAGATAGC TGG (reversed) Intronic
901097525 1:6694185-6694207 TAAGTAGGAAGCAGGGTACCGGG - Intronic
904761703 1:32809619-32809641 TTACTAGTAAGCAAGAGATCTGG + Intronic
909430400 1:75581810-75581832 GAAATAGGAAGCAAGAGAGAGGG - Intronic
915081706 1:153357227-153357249 TAACCAGGAACCAGAATAGCTGG + Intergenic
915584790 1:156838604-156838626 TAACTAGGTAGCAAGATAGATGG - Intronic
916193245 1:162199058-162199080 TAACAATGAAGCAGGATAACTGG - Intronic
916867668 1:168877985-168878007 TAAATAGGAAGGAAGAGAACAGG + Intergenic
920834583 1:209497879-209497901 GAAGGAGGAAGCAAGAGAGCAGG + Intergenic
921464448 1:215469813-215469835 CAAGTAGGAACCAAGATTGCAGG + Intergenic
922975205 1:229778454-229778476 TAACAAGGAAGAAAGGGAGCTGG + Intergenic
922984927 1:229858946-229858968 TATCTAGAAAGCGAGAGAGCAGG + Intergenic
923314959 1:232771497-232771519 TACCTAGGAAGTAACAAAGCAGG + Intergenic
924423350 1:243929818-243929840 TAACTTAGAAGCAAATTAGCAGG - Intergenic
1069099742 10:64305307-64305329 GAACAAGCAAGCAAGCTAGCTGG + Intergenic
1069762795 10:70825666-70825688 TTCCTAGGCAGCAAGAAAGCTGG - Intronic
1072504432 10:96050365-96050387 TAAATAGACAGCAAGATGGCGGG - Exonic
1076255330 10:129018955-129018977 TAACAAGAAAGAAAGATAGCTGG + Intergenic
1078872531 11:15362493-15362515 TAAACAGGAAGAAAGATAGCAGG + Intergenic
1078899973 11:15632653-15632675 TGAGAAGGCAGCAAGATAGCAGG + Intergenic
1081260285 11:40951365-40951387 AAACTAAGAAGCACAATAGCAGG - Intronic
1083731500 11:64654805-64654827 TTACTGGGAAGCAAGGGAGCTGG + Intronic
1085611558 11:77954939-77954961 CTACTAGGAATTAAGATAGCCGG - Intronic
1086336831 11:85809581-85809603 TAGCTAGGAAGTAGCATAGCTGG - Intronic
1086407888 11:86514630-86514652 TAGCTAGGAAGTAATAGAGCTGG - Intronic
1086869392 11:92018510-92018532 TACCTAGGGAGCCAGAGAGCAGG + Intergenic
1089100308 11:115957595-115957617 TAAGTAGGGAGTAAGACAGCTGG + Intergenic
1089783514 11:120891697-120891719 TATCTAGTAAGAAAGATAGGCGG + Intronic
1091556798 12:1580138-1580160 TAACTAGGAAGAAGGCTATCTGG + Intronic
1092011329 12:5115225-5115247 AAAATAGGAAGAAAGAAAGCAGG - Intergenic
1092520363 12:9266402-9266424 TAAATAAGAAGCCAGAGAGCTGG - Intergenic
1093347279 12:18053689-18053711 AAACTAGGAAGCTACATAGAAGG - Intergenic
1095110248 12:38287068-38287090 TAATTAGGAGTCAAGATATCTGG - Intergenic
1095842545 12:46709980-46710002 TAACAAGTAAGCAAGGAAGCAGG - Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097596714 12:61642444-61642466 CTACTAGGAAGCAATAAAGCAGG - Intergenic
1097950679 12:65424344-65424366 AAACTAGGCAAAAAGATAGCAGG - Intronic
1098884320 12:75945005-75945027 AAAGTAGGAAGGAAGAGAGCAGG + Intergenic
1099038521 12:77620778-77620800 GAAAAAGGAACCAAGATAGCTGG + Intergenic
1099412613 12:82349740-82349762 TCAGTAGGAAGGAAGATAACCGG + Intronic
1101266126 12:103089664-103089686 TCACTATGAATCAAGATGGCTGG - Intergenic
1104543702 12:129691847-129691869 TAACTAGGATTTAAGATAGATGG + Intronic
1105424615 13:20283792-20283814 TAACTAGGAACCATGACAGCTGG - Intergenic
1108966144 13:56304530-56304552 AAACTAGGAATGAAGATACCAGG + Intergenic
1110163238 13:72404959-72404981 TAACTAGGAATAAAGAAAGTAGG + Intergenic
1111849557 13:93555023-93555045 AAACTTTGAAGTAAGATAGCAGG + Intronic
1115711324 14:36054338-36054360 TATTTTGGAAGCAAGATGGCTGG + Intergenic
1116358819 14:43966769-43966791 TAACTAGGAATACAGCTAGCCGG + Intergenic
1118039467 14:61901375-61901397 TAACTAGCAACAAAGATGGCTGG - Intergenic
1119824014 14:77642085-77642107 GAAGTCGGAAGCAAGATAGCGGG + Intergenic
1122059652 14:99128527-99128549 TTACTAAGAATCAAGAGAGCAGG + Intergenic
1202843056 14_GL000009v2_random:141736-141758 AACCTAGGAAGCAAGAAATCTGG + Intergenic
1202912458 14_GL000194v1_random:131987-132009 AACCTAGGAAGCAAGAAATCTGG + Intergenic
1123924082 15:25091422-25091444 TACCCAGGAATGAAGATAGCAGG - Intergenic
1126324369 15:47460557-47460579 TAAGAAGGAAGAAAGACAGCTGG + Intronic
1131000902 15:88939172-88939194 GAAGCAGGAAGCAAGCTAGCTGG - Intergenic
1134234531 16:12455105-12455127 GGAGTAGGAGGCAAGATAGCTGG + Intronic
1135763635 16:25157840-25157862 TTACTGGGAAGCAAGAAAGGTGG - Intronic
1141927824 16:87180873-87180895 TAACTAGGAAGGAAGGAGGCCGG + Intronic
1146861395 17:36302906-36302928 TAGCTAGTAAGTAACATAGCTGG + Intronic
1147091726 17:38107010-38107032 TAGCTAGTAAGTAACATAGCTGG + Intergenic
1147105486 17:38213491-38213513 TAGCTAGTAAGTAACATAGCTGG - Intergenic
1148025587 17:44585398-44585420 GAACGAGGATGCAAGATAGAGGG - Intergenic
1148424017 17:47574988-47575010 TAGCTAGTAAGTAACATAGCTGG + Intronic
1148503028 17:48106479-48106501 TAAATAAAAAGGAAGATAGCTGG - Intronic
1150960910 17:69911167-69911189 CAACTAGTAAGCAAGGGAGCTGG - Intergenic
1151333173 17:73423290-73423312 GAACTAGGAAGCAGGAGAGCTGG + Intronic
1156061553 18:33083220-33083242 TAGCTAGGAAGCAAAAGGGCAGG + Intronic
1156917921 18:42483641-42483663 TAATTATGAAACAAGATAGTGGG + Intergenic
1160106340 18:75981506-75981528 TAGCTAGGAAGCAAGGGAGTTGG - Intergenic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1167163742 19:47784194-47784216 TTAAAAGGAAGAAAGATAGCCGG - Intronic
925695982 2:6579060-6579082 GAACTAGGAAGAAAGAAAGTTGG - Intergenic
927384111 2:22513318-22513340 TAAATAGGAAAGAAGATAGGAGG + Intergenic
929173915 2:38958566-38958588 TAACTTGGAAGAAAGATTGGGGG - Intronic
933800069 2:85953599-85953621 GAACGAGGAAGCAAGGAAGCAGG - Intergenic
934744511 2:96750293-96750315 GAATTAGGAAGCAATTTAGCTGG - Intergenic
937089255 2:119195039-119195061 CAACTTGGAAGCAAAAGAGCAGG + Intergenic
938371325 2:130770252-130770274 TATCTATGTAGCAAGATTGCTGG + Intergenic
940043657 2:149386943-149386965 TAACTGGGAAGCAAGATAGCTGG - Intronic
942704810 2:178758709-178758731 TGATTAGGAAGCATGACAGCTGG + Intronic
943683778 2:190794849-190794871 CAGCTAGGAAGACAGATAGCTGG - Intergenic
945962075 2:216146131-216146153 TAATTAGGAAAGAAGAAAGCAGG + Intronic
1176631816 21:9146660-9146682 AACCTAGGAAGCAAGAAATCTGG + Intergenic
1178622516 21:34188962-34188984 CAACTAGGAAGTAAGAGAGCTGG + Intergenic
1178940700 21:36902623-36902645 TAAATAGGAAGCAAGATCATCGG + Intronic
1179187838 21:39098240-39098262 TAATTAGGAGGAAAGATTGCTGG - Intergenic
1180943014 22:19672102-19672124 TAACTTGGAAGCAACAAACCAGG - Intergenic
1182579572 22:31297945-31297967 TAGCTAGGAAGCAACAGAGCTGG - Intergenic
1183724640 22:39581589-39581611 GAACTAGAAAGCAAGCTGGCCGG + Intronic
949181543 3:1137119-1137141 TACCAGGTAAGCAAGATAGCTGG - Intronic
958667606 3:97160656-97160678 GAACTTGGAAGGAAGATAACAGG - Intronic
959450779 3:106497033-106497055 TATCTGGGAAGCAAAATAGGTGG - Intergenic
961175598 3:124832532-124832554 TCACCAGGAAGCAAGAGACCAGG + Intronic
961527977 3:127519662-127519684 GAACTAAGAAGCCAGATTGCTGG + Intergenic
962577500 3:136768346-136768368 TCACTAGGAATCAAGTCAGCTGG + Intergenic
963162126 3:142161640-142161662 TAAAAAGGAAGCAAAAAAGCAGG + Intergenic
963899243 3:150718159-150718181 TAACAAGGGAGAAAGAAAGCAGG - Intergenic
965424140 3:168499945-168499967 TAACTAGAAAGCAATGGAGCTGG - Intergenic
965889399 3:173492011-173492033 TGACAAGGAAGCAAGATAGTGGG + Intronic
968857260 4:3135570-3135592 TGAGTGGGCAGCAAGATAGCAGG + Intronic
970242698 4:14025925-14025947 TCAATTGGAAGCAAGTTAGCTGG - Intergenic
971202509 4:24523849-24523871 TAACTAGGAATCAAGGTTGCTGG - Intronic
971454888 4:26834885-26834907 TGAGTAGAAAGCATGATAGCTGG - Intergenic
972505963 4:39720291-39720313 AAACTGGGAAACAAGATAGTGGG + Intronic
981878246 4:149575752-149575774 TAACTAGGAATCTACATAGGTGG - Intergenic
982849588 4:160295945-160295967 TAAATGGGAAGCAAGATTGAAGG - Intergenic
983335549 4:166387245-166387267 TAAATTGGAAGCATCATAGCTGG + Intergenic
983765763 4:171480746-171480768 TGTCCAGGAAGCAAGATTGCAGG + Intergenic
983796424 4:171869578-171869600 TATTTGGGAGGCAAGATAGCAGG - Intronic
983877881 4:172897616-172897638 GAACTTGGAAGCAAGATTGATGG + Intronic
987656000 5:20806915-20806937 AAAAGAGGAAGCAAGAGAGCAGG + Intergenic
987733993 5:21815143-21815165 TAACAAGGAAGCAATATATATGG - Intronic
990007030 5:50955565-50955587 TAACAAGGAAGCCAGATACAAGG + Intergenic
992679165 5:79136145-79136167 TACCTAGGAAGGGAGAGAGCTGG + Intronic
996437334 5:123449340-123449362 TAACTTGTAAGCCAGAAAGCAGG - Intergenic
999292437 5:150435112-150435134 AAACTAGCCAGCATGATAGCAGG + Intergenic
1003939535 6:11010380-11010402 TAACTAGGATGTAAGAAAGGTGG + Intronic
1005498167 6:26406927-26406949 TATCTAGGAAGAAAGAGACCAGG + Intronic
1009718368 6:67429090-67429112 TAACTAGGAAGCAATATTTCTGG - Intergenic
1009738149 6:67706202-67706224 GAACTAGCAAACAAGATACCTGG + Intergenic
1011708547 6:90027690-90027712 CAGCTAGGAAGCAGGAGAGCAGG - Intronic
1012408531 6:98929273-98929295 AAACTAAGAAGAAAGTTAGCTGG + Intronic
1012514796 6:100047110-100047132 TCACTGGGAAGTAAAATAGCTGG + Intergenic
1012624474 6:101390250-101390272 TAAGTGGGAAGCAAGATACCGGG + Intergenic
1014190601 6:118491996-118492018 TAACTAGGAAGCAAGATAGCTGG - Intronic
1020548747 7:9570479-9570501 TAACTAGGAAGCAGCAGAGGAGG + Intergenic
1021979219 7:26038321-26038343 TAAGTGGGAAGCAGGATAGGAGG - Intergenic
1022839192 7:34146697-34146719 GAGCTAGGAAGCAAGGAAGCTGG + Intronic
1025112362 7:56229579-56229601 AAACTAGACAGCAAGATGGCGGG + Intergenic
1025280509 7:57623658-57623680 TGAATAGGAAGCAAGGCAGCAGG - Intergenic
1025304222 7:57841849-57841871 TGAATAGGAAGCAAGGCAGCAGG + Intergenic
1025748627 7:64270904-64270926 TCACTAGGCAGCAAGAGAGCAGG - Intergenic
1025841537 7:65154112-65154134 CTACTAGGAATTAAGATAGCCGG + Intergenic
1025881512 7:65541854-65541876 CTACTAGGAATTAAGATAGCCGG - Intergenic
1025891927 7:65660761-65660783 CTACTAGGAATTAAGATAGCCGG + Intergenic
1030635357 7:111942112-111942134 TAAGTAGGAAGGAAGGTAGTGGG + Intronic
1034633980 7:152552860-152552882 TAACTACCAAGCAACATGGCTGG + Intergenic
1043503936 8:80884450-80884472 GCAATAGGAAGCAAGATATCAGG - Intergenic
1046407658 8:113795325-113795347 GAACTTGGAATCAAGAGAGCAGG - Intergenic
1052618845 9:30879169-30879191 TAACAAGAAAGCATGATAGCAGG - Intergenic
1055237167 9:74137027-74137049 TAGCTAGTAAGCAGGAGAGCTGG - Intergenic
1055777584 9:79782672-79782694 ATCCTAGGAAGCAAGAGAGCAGG - Intergenic
1056898113 9:90570120-90570142 TTACTAGTGAGCATGATAGCTGG + Intergenic
1057466966 9:95323165-95323187 TAAGTAGGAAGCAGGAGAGAGGG - Intergenic
1057474423 9:95386555-95386577 TAACAGGGAAGCAAGATGGTGGG - Intergenic
1059486719 9:114632905-114632927 TAGCTAGGAAGCAGCAGAGCTGG + Intronic
1059714880 9:116904483-116904505 TAGGTAGTAAGCAACATAGCTGG - Intronic
1203754643 Un_GL000218v1:114268-114290 AACCTAGGAAGCAAGAAATCTGG + Intergenic
1203631881 Un_KI270750v1:78442-78464 GAAGTAGGAAGCAAGGCAGCAGG - Intergenic
1186701835 X:12098871-12098893 TAATTAGGAAGCAAAATAAGGGG - Intergenic
1188039103 X:25351150-25351172 TACCTAGAATTCAAGATAGCTGG - Intergenic
1190231149 X:48582882-48582904 TAACTAGCAAGGAAAATAGCTGG - Intergenic
1191225873 X:58042744-58042766 TGTGTAGGAAGCAAGATATCAGG + Intergenic
1191736755 X:64395540-64395562 TTGCCAGGAAGCAAGATGGCGGG - Intergenic
1191796605 X:65028160-65028182 TAGCTAGCTAGCTAGATAGCTGG - Intronic
1192215039 X:69152182-69152204 TAGCTAGGAAGCAGCAGAGCTGG - Intergenic
1193363443 X:80602468-80602490 TAATCAAGAAGCAAGATAGGAGG - Intergenic
1194941883 X:100020246-100020268 TAACTAGTAAGCAAGTGAGCTGG + Intergenic
1196020868 X:110989746-110989768 CAACTAGGAGGCAGGAAAGCTGG - Intronic
1197187999 X:123609708-123609730 TAACATGGAAGCAAGAAAACGGG + Intronic
1200908178 Y:8507125-8507147 AAAATTAGAAGCAAGATAGCTGG - Intergenic