ID: 1014197495

View in Genome Browser
Species Human (GRCh38)
Location 6:118576631-118576653
Sequence TCCCCCCATATGCAAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014197495_1014197502 8 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197502 6:118576662-118576684 AGGAAGAGTTAGGCAATTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 202
1014197495_1014197500 6 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197500 6:118576660-118576682 AGAGGAAGAGTTAGGCAATTGGG No data
1014197495_1014197499 5 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197499 6:118576659-118576681 CAGAGGAAGAGTTAGGCAATTGG 0: 1
1: 0
2: 1
3: 16
4: 218
1014197495_1014197503 14 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197503 6:118576668-118576690 AGTTAGGCAATTGGGGGTTATGG 0: 1
1: 0
2: 0
3: 25
4: 261
1014197495_1014197505 24 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197505 6:118576678-118576700 TTGGGGGTTATGGTCTCAGTGGG 0: 1
1: 0
2: 1
3: 4
4: 120
1014197495_1014197497 -2 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197497 6:118576652-118576674 GAATCCTCAGAGGAAGAGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 270
1014197495_1014197504 23 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197504 6:118576677-118576699 ATTGGGGGTTATGGTCTCAGTGG No data
1014197495_1014197501 7 Left 1014197495 6:118576631-118576653 CCTGTGTCTTGCATATGGGGGGA 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1014197501 6:118576661-118576683 GAGGAAGAGTTAGGCAATTGGGG 0: 1
1: 0
2: 1
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014197495 Original CRISPR TCCCCCCATATGCAAGACAC AGG (reversed) Intronic
900523162 1:3115919-3115941 GCCCCCCAGATGCTGGACACAGG - Intronic
905880526 1:41460389-41460411 TCCCCCCATTGTCAAGACACTGG - Intergenic
907078198 1:51596818-51596840 TCCTCCTATATGCCAGGCACTGG + Intronic
907896148 1:58693967-58693989 TCCCACCATATTCTAGACACTGG + Intronic
920625789 1:207597288-207597310 TCCCCCCTTTTGAAAGACAAAGG + Intronic
1070739559 10:78893785-78893807 TCCTCCCATATGCAAGATGATGG - Intergenic
1073788325 10:106914493-106914515 TCCCCTCACATGCAAAATACTGG + Intronic
1074787709 10:116855652-116855674 TCCCACCATATGCAAAATAGTGG + Exonic
1082105458 11:48216605-48216627 GCCTACCCTATGCAAGACACTGG - Intergenic
1084488166 11:69463266-69463288 TCAGCCCATGTGCAGGACACGGG - Intergenic
1085576517 11:77609438-77609460 TCACCTCATATGGAAAACACCGG + Exonic
1090418825 11:126559363-126559385 ACTCCCTATGTGCAAGACACTGG + Intronic
1092027695 12:5256823-5256845 GCCCACCATGTGCCAGACACAGG + Intergenic
1094061526 12:26319565-26319587 TGGCCCCATATGCAACAGACAGG - Intergenic
1096797722 12:54088615-54088637 TTCCCTCATTTGCAAAACACAGG - Intergenic
1099619074 12:84977180-84977202 TCCCCACATCTGCAGGATACCGG - Intergenic
1106882626 13:34148477-34148499 TCCCCTCATATGCATTTCACAGG - Intergenic
1111517980 13:89360358-89360380 TCCCCCAATATTCAAGAAAAGGG + Intergenic
1121029540 14:90646264-90646286 ACCCACCAGGTGCAAGACACTGG - Intronic
1121618123 14:95327442-95327464 TCACCCCATATGCAACTGACTGG - Intergenic
1124587418 15:31022640-31022662 TCCCTCCAGGTTCAAGACACTGG - Intronic
1133394281 16:5433519-5433541 CCCTCCCATTTGCAAGAGACTGG - Intergenic
1136061765 16:27731405-27731427 TTGCCACATATGCAAGAAACAGG - Intronic
1138884650 16:61061600-61061622 TCCCCTTATGTGCAAGACATTGG + Intergenic
1141048224 16:80736473-80736495 TCCCCTCATATTCAAGAGACTGG - Intronic
1147508425 17:41044140-41044162 GCCTACCATATGCAAGTCACAGG - Intergenic
1152789698 17:82272730-82272752 CCCCCACGAATGCAAGACACCGG + Intronic
1161572037 19:5036063-5036085 GCCCCCCATTTGGAAGACGCAGG - Intronic
1164884806 19:31769580-31769602 TCCCTGCATCTGAAAGACACTGG - Intergenic
1165871716 19:38977344-38977366 TCCCTACATATGCAAGCCCCTGG - Intergenic
1167662939 19:50806863-50806885 TGCAACCATATGCTAGACACTGG - Intergenic
1167672998 19:50866342-50866364 TCTCCTCATATGCAATCCACTGG + Intronic
925762655 2:7200603-7200625 TCCTACCATATGCTGGACACTGG + Intergenic
926884541 2:17585112-17585134 TCACCCCATAAGCATGAAACAGG - Intronic
927793043 2:26025875-26025897 TCCCACTACATGCAAGACACTGG + Intergenic
933152473 2:78931900-78931922 TTCCTCCAGCTGCAAGACACTGG + Intergenic
939616504 2:144367366-144367388 GCCTCCAATGTGCAAGACACCGG - Intergenic
941542823 2:166807746-166807768 TCTCCCCTTTTGAAAGACACAGG - Intergenic
941652221 2:168104325-168104347 TCCCACAACATGCAAAACACTGG + Intronic
942123880 2:172804138-172804160 TACCACCATATGCAAGAAAGAGG - Intronic
944516198 2:200514203-200514225 TCCCCCCATATTCCAGAATCAGG - Intronic
1175948972 20:62572331-62572353 TCCCCCCATCAGGAGGACACAGG + Intergenic
1176337854 21:5615612-5615634 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176339262 21:5678685-5678707 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176471516 21:7110838-7110860 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176495077 21:7492616-7492638 GCTCCCCATAGGCAAGACCCAGG - Intergenic
1176505565 21:7645771-7645793 GCTCCCCATAGGCAAGACCCAGG + Intergenic
1181548446 22:23619742-23619764 TCCCTCCATTTCCAAGACACTGG + Intronic
1181548859 22:23624015-23624037 TCCCTCCATTTCCAAGACACTGG + Intronic
1181769807 22:25117221-25117243 TCTCCCCATATTTAAGTCACTGG - Intronic
1181799812 22:25338102-25338124 TCCCTCCATTTCCAAGACACTGG - Intergenic
1181972191 22:26699281-26699303 TCCTCCCTTCTGCAAGACACAGG - Intergenic
1182552287 22:31106916-31106938 TCCTCCCATATGCAGGATCCGGG - Intronic
1183324399 22:37183628-37183650 TCCCCCCCTGTGGAAAACACAGG - Intronic
1183913411 22:41096498-41096520 TTCCCCCATTTCAAAGACACAGG + Intronic
1184336417 22:43855764-43855786 TCCCCCTAGATGCAGGACACTGG + Intronic
1184839972 22:47046817-47046839 TCCCCCCAGATGCCAGACCAAGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954383437 3:50231833-50231855 TCCCTCCACTTGCAACACACTGG - Intronic
955780302 3:62477516-62477538 TCCTCCCATATGCCAGGCACAGG - Intronic
956338828 3:68196563-68196585 TCTCCCTATATGCAATACTCTGG - Intronic
959234412 3:103700497-103700519 TTACCCCATATGGAAGATACAGG + Intergenic
964729336 3:159848383-159848405 TCTCCCCATTTGCAAGCTACTGG + Intronic
966235287 3:177694476-177694498 GCCTCCCATATGCAAAACAGTGG + Intergenic
970827251 4:20290671-20290693 AACCACCATATGCCAGACACTGG - Intronic
972607850 4:40630368-40630390 TCCCCCCATAAACAAGTCGCTGG + Intronic
972669000 4:41195803-41195825 TCCCGCCATATGCACAACCCAGG + Intronic
976831819 4:89323709-89323731 TCCACCTATATGCTAGGCACTGG - Intergenic
977064936 4:92303670-92303692 TCCCCCTATCTGCAATACAAGGG - Intronic
984547120 4:181119698-181119720 TTCCCCCATTTGAAAGATACAGG - Intergenic
985650905 5:1107058-1107080 TACCCCCATGTGTAACACACGGG + Intronic
990559940 5:56973826-56973848 TTCCCCCATAGTCATGACACAGG - Intergenic
991434805 5:66586853-66586875 TCCCCCCACTTCCAAGAGACAGG + Intergenic
1003774384 6:9343497-9343519 GGCCACCATATGCAAGAGACAGG - Intergenic
1006151203 6:31991178-31991200 TCTCCCCACCTGCAAGACAAAGG - Exonic
1006157504 6:32023916-32023938 TCTCCCCACCTGCAAGACAAAGG - Exonic
1014197495 6:118576631-118576653 TCCCCCCATATGCAAGACACAGG - Intronic
1022730130 7:33015050-33015072 TCACCCCATTTGAAAGCCACTGG - Intronic
1026614497 7:71889456-71889478 TCCCCCCATTTGCAAATCACTGG + Intronic
1035192556 7:157184036-157184058 GCCCCCCAGATGCAGGGCACGGG - Intronic
1036211018 8:6841463-6841485 ACCCCATATATGCAACACACAGG - Intergenic
1036746552 8:11413959-11413981 TCACCCCATATCCAAGCCTCAGG - Intronic
1038278097 8:26138752-26138774 CCTTCCCACATGCAAGACACTGG + Intergenic
1038313209 8:26461860-26461882 TCCCTCCATTTTCAAGACCCTGG + Intronic
1040467095 8:47705263-47705285 TCCCCTCCTATCCAAGAAACAGG + Intronic
1044345441 8:91098952-91098974 TCCTCCCATATGCAAAACAGAGG - Intergenic
1044533709 8:93336891-93336913 TTCCCCCAGCTGCAAGACACTGG + Intergenic
1049946605 9:603053-603075 TTTCCCCATATGTAAGAAACAGG - Intronic
1050034150 9:1417355-1417377 TGCCCCCATATGCATGCCAAGGG + Intergenic
1059259520 9:112962367-112962389 TACCCCCATGGGCAAAACACTGG - Intergenic
1059430659 9:114248368-114248390 TCCTCTCATATGCTAGGCACTGG - Intronic
1059663756 9:116426433-116426455 TGACACCATATGCTAGACACTGG + Intronic
1060437242 9:123604533-123604555 CCCCACCACATGCCAGACACTGG + Intronic
1062036900 9:134386436-134386458 ACACTCCATAGGCAAGACACAGG - Intronic
1062178936 9:135180322-135180344 TCCACCCATATGTGAGACTCAGG - Intergenic
1189390785 X:40574794-40574816 TCCCCCATTATGCCAGACCCTGG - Intergenic
1196941519 X:120781046-120781068 TCCCCCACTTGGCAAGACACGGG - Intergenic