ID: 1014198392

View in Genome Browser
Species Human (GRCh38)
Location 6:118583513-118583535
Sequence TGGGGCTGTAAAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014198392_1014198403 29 Left 1014198392 6:118583513-118583535 CCTGCAGCATCTTTACAGCCCCA 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1014198403 6:118583565-118583587 CTAACATTAATGTGGAAGTGTGG 0: 1
1: 0
2: 2
3: 20
4: 185
1014198392_1014198404 30 Left 1014198392 6:118583513-118583535 CCTGCAGCATCTTTACAGCCCCA 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1014198404 6:118583566-118583588 TAACATTAATGTGGAAGTGTGGG 0: 1
1: 0
2: 1
3: 22
4: 274
1014198392_1014198402 21 Left 1014198392 6:118583513-118583535 CCTGCAGCATCTTTACAGCCCCA 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1014198402 6:118583557-118583579 GATGGAAGCTAACATTAATGTGG 0: 1
1: 0
2: 2
3: 9
4: 140
1014198392_1014198397 3 Left 1014198392 6:118583513-118583535 CCTGCAGCATCTTTACAGCCCCA 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1014198397 6:118583539-118583561 CAAACTCTATCTCCCCCTGATGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014198392 Original CRISPR TGGGGCTGTAAAGATGCTGC AGG (reversed) Intronic
901198373 1:7453067-7453089 TGAGGCAGCAAAGCTGCTGCTGG + Intronic
904455583 1:30646132-30646154 TGAGGCTGGAAAGATGCTGGAGG + Intergenic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
907629734 1:56068363-56068385 TGGTGCCTTTAAGATGCTGCTGG - Intergenic
910094931 1:83510937-83510959 TTGAGCTGTAAGGATGCTGGTGG - Intergenic
911454964 1:98111097-98111119 TGGGGCTGGAAAGGGGCTGTAGG + Intergenic
915264481 1:154706806-154706828 TGGGGCTGGAAACCTGTTGCTGG + Exonic
915316801 1:155033365-155033387 TGGGGCAGAAGAGATGCTGGAGG - Intronic
916115892 1:161484836-161484858 TGGGGCTATAAGGATGCTGGTGG + Intergenic
919459056 1:197855071-197855093 TAGGGCTGTAAAGGCGATGCAGG - Intergenic
919859640 1:201730941-201730963 TGGGGGTCCAAAGATGCTGAAGG + Intronic
920122761 1:203671119-203671141 TTGGAATATAAAGATGCTGCAGG - Intronic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
922478186 1:225921350-225921372 GGGAGCTGCCAAGATGCTGCTGG - Exonic
924084837 1:240440289-240440311 TGGGGCTGTGAGGATGCTTAGGG - Intronic
1065442008 10:25762584-25762606 TGGGGCTGTGAAAATGATACTGG + Intergenic
1067101957 10:43340315-43340337 TGGGGCAGTGAAAATGCTACGGG + Intergenic
1067470135 10:46530516-46530538 TGTGGCTGTAAAAGCGCTGCGGG - Intergenic
1067524372 10:47029331-47029353 TGGGGCTGCACAGAGGCTGTGGG - Intergenic
1070103879 10:73414018-73414040 TTGGGCTGTGACGCTGCTGCTGG - Exonic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1070931723 10:80265847-80265869 TGGGGCCCTGAAGCTGCTGCTGG + Intergenic
1072670331 10:97424813-97424835 TGTTGCTGTGAAGTTGCTGCAGG + Intronic
1072808938 10:98445064-98445086 AGGAGCTTTAAAGATGCAGCAGG + Intronic
1073640428 10:105247212-105247234 TGGGACTGGAAATATTCTGCAGG - Exonic
1075271387 10:121054651-121054673 AGGTGCTGGAGAGATGCTGCAGG - Intergenic
1076898176 10:133324574-133324596 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898185 10:133324607-133324629 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898194 10:133324640-133324662 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1077409942 11:2399258-2399280 TTGGCCTGCAAAGAGGCTGCTGG - Intergenic
1077598591 11:3556408-3556430 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1081938314 11:46919377-46919399 TGGGGCTGGAAGGAGGCTGAGGG - Intergenic
1082799783 11:57406154-57406176 TGGGGCTATAAAGATGCAGAAGG - Intronic
1084254673 11:67932280-67932302 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084691980 11:70732806-70732828 TGGGGATGTGAAGCAGCTGCAGG - Intronic
1084818200 11:71663607-71663629 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1087508573 11:99060157-99060179 TGGGCCTGTAAATAAGCTGTTGG + Intronic
1090989846 11:131806940-131806962 TGGGGATATAAAGAAACTGCTGG + Intronic
1091002485 11:131922006-131922028 TGGAGATGTAAAAATGTTGCTGG - Intronic
1091676695 12:2496231-2496253 TGGTGCTGGTATGATGCTGCTGG + Intronic
1092030389 12:5278719-5278741 TGGGGCTGGAAAAAGGTTGCTGG - Intergenic
1092371090 12:7917013-7917035 TGGTGCTGGAAGGATACTGCAGG + Intergenic
1092424739 12:8365759-8365781 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1096579122 12:52573205-52573227 TGTGGCTGGAAAGGTGCAGCTGG - Intronic
1098611994 12:72470160-72470182 AGGGGCTCCAAAGAGGCTGCTGG - Intronic
1101027328 12:100623934-100623956 TTGGGATGAGAAGATGCTGCTGG - Exonic
1102012717 12:109628533-109628555 TGGGGCTCTGGAGATTCTGCAGG - Intergenic
1104926758 12:132317808-132317830 TGGGGCTGCACAGGGGCTGCTGG + Intronic
1106291034 13:28362389-28362411 TGTGGCTGTACAGTTGCTCCGGG + Intronic
1107125190 13:36838960-36838982 TGGGCCTTTAGAGATTCTGCTGG + Intergenic
1107134972 13:36933771-36933793 TGTGGCTATAAAGAAGCAGCAGG - Intergenic
1112367883 13:98771446-98771468 TGGGGATGTGAAGAGGCTGAGGG - Intergenic
1112501941 13:99949800-99949822 GGGGGCTGAAAAGCTCCTGCTGG + Intergenic
1113366826 13:109684186-109684208 TGTGGCTGCATTGATGCTGCTGG - Intergenic
1113574191 13:111382602-111382624 TGGGGTTGTGGAGATGCTGAGGG + Intergenic
1119175494 14:72565232-72565254 TGGGGCTGCCAAGATGTGGCTGG - Intronic
1120607526 14:86597541-86597563 TGGGGCTGTGATGGTGCTGGGGG + Intergenic
1121665520 14:95669107-95669129 CAGGGCTGGAAAGAGGCTGCTGG + Intergenic
1122273896 14:100581371-100581393 TGAGGCTCTAAGGATGCTGCCGG + Intronic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1124136930 15:27043100-27043122 TGGGGCTGGAAAGATGGGGTGGG - Intronic
1125384461 15:39122565-39122587 TGGGGCTGTAAAAGTGTTACAGG - Intergenic
1126355629 15:47792803-47792825 TGGAGCTTTAGAGATGTTGCAGG - Intergenic
1127992815 15:64133314-64133336 TTGAGGTGTTAAGATGCTGCAGG + Intronic
1130826806 15:87557195-87557217 TAGGGCTTTGAAGAAGCTGCAGG + Intergenic
1130858789 15:87867185-87867207 GGGGGCTGGAAAGATACTGATGG + Intronic
1132765983 16:1534403-1534425 TGGGGCTGTGGAGGTCCTGCTGG + Exonic
1134080217 16:11319806-11319828 TGGGTCTGAGAAGGTGCTGCAGG - Intronic
1135973111 16:27086722-27086744 TGGGGCTGTAAAAATACTCCAGG - Intergenic
1136577731 16:31134344-31134366 TGGGGCTGTGGAGAGGATGCAGG - Intronic
1137754703 16:50892191-50892213 TGGGGCTGTAAAGATGCCCCTGG + Intergenic
1139209661 16:65064973-65064995 TGGGGCGGTTTAGATGCTGTAGG - Intronic
1139791009 16:69435356-69435378 TGGTACTCAAAAGATGCTGCAGG - Intronic
1140509769 16:75498725-75498747 TGAGGGTGTAAAGAGGATGCTGG - Intergenic
1140857297 16:78989401-78989423 TGGTGCTGTTAAGATTCTGCAGG - Intronic
1141950511 16:87336303-87336325 GGAGGCTGTGAAGAGGCTGCCGG + Intronic
1142121341 16:88388050-88388072 TGGGGTTGTAAAGAGACTCCAGG - Intergenic
1142299986 16:89251415-89251437 TGAGGATGTACAGATGCTGCGGG - Intergenic
1143414384 17:6735367-6735389 TGGGGCTGTAAAGAGTCTAAGGG + Intergenic
1144666927 17:17108224-17108246 TGCAGCTGTAAAGAGCCTGCTGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148630770 17:49106648-49106670 TGGGGCTGGGAAGAAGCTTCGGG - Intergenic
1151371645 17:73650356-73650378 GGGTGCTATAAACATGCTGCTGG + Intergenic
1152081194 17:78188254-78188276 TGTGGCTGTAAGGATCCTACAGG + Intronic
1152198802 17:78933406-78933428 TGGGGCTGTGAAGGTTGTGCCGG - Intergenic
1152332646 17:79682038-79682060 TGGGGCTGCCCAGATGCCGCAGG + Intergenic
1157429598 18:47613917-47613939 TGGGCCTGTAAAGAGGATCCAGG - Intergenic
1160083887 18:75756253-75756275 TGGGGCTGAGAAGATGCTCCAGG - Intergenic
1161355751 19:3818908-3818930 TGGGGCTGGAAAGCTGCCGCGGG + Intronic
1161405344 19:4088381-4088403 TGGGGCTCCAATGAAGCTGCAGG + Intergenic
1161728491 19:5944688-5944710 TCGGGCTGTGCAGAGGCTGCTGG - Intronic
1163009150 19:14413783-14413805 TGGGGCTGCCAGGATGCTGGTGG + Intronic
1163625303 19:18386142-18386164 TGGGACTGACCAGATGCTGCCGG - Exonic
1163650244 19:18513303-18513325 TGGGGATGTCCGGATGCTGCAGG - Intronic
1164785581 19:30927814-30927836 TGGAGCTGGAGAGATGCTGAGGG - Intergenic
1164933797 19:32195856-32195878 TGGGGATGTGGGGATGCTGCAGG + Intergenic
1165403273 19:35615183-35615205 TGGGGCGGGAAAGGTGCTGATGG + Intronic
1166059139 19:40314094-40314116 TCAGGCTCTAGAGATGCTGCAGG - Intergenic
1168433580 19:56300932-56300954 TGGTGCTAGAAAGATCCTGCTGG + Intronic
926011125 2:9408773-9408795 GTGGGCTGTAAAAATGCGGCTGG - Intronic
927683762 2:25157000-25157022 TGGCTCTGGAAAGATGCTCCAGG - Exonic
929604992 2:43227684-43227706 TGGGGCTGCACAGACGCTGATGG + Intergenic
932197531 2:69797306-69797328 TGGGGCTGCAACTATGGTGCTGG - Intronic
932349417 2:71020409-71020431 TTGGGCCGTAAAGGAGCTGCCGG - Intergenic
932416363 2:71575915-71575937 TGTGGTAGCAAAGATGCTGCTGG + Intronic
933314365 2:80698728-80698750 TTCTGCTGTAAAGATACTGCTGG + Intergenic
934753963 2:96812388-96812410 TGGTGCTGTACAGGTGCTGCAGG + Intergenic
935146019 2:100396049-100396071 TGGGGCTGTGAAGCTGCTGCGGG - Intronic
935444761 2:103144501-103144523 TGCTTCTGTAATGATGCTGCTGG - Intergenic
936013616 2:108941836-108941858 TGAGGCTGGGAAGAGGCTGCTGG - Intronic
936083587 2:109451864-109451886 TGGGGCTGGACACATGCTGTGGG + Intronic
936573563 2:113635507-113635529 TGGGACTGAGTAGATGCTGCGGG + Intronic
937276249 2:120685945-120685967 TGAGGCTGATAAGATGCTGAGGG - Intergenic
938114120 2:128591763-128591785 TGTGGCTGCAGAGATGCTGGTGG + Intergenic
938639643 2:133265984-133266006 TGGGGGCGTAAAGGGGCTGCAGG - Intronic
943736929 2:191366513-191366535 TGGGGCAATAAAGATGATGCTGG - Intronic
945344566 2:208697650-208697672 TTGGGCTGTGAAGAAGCTGTTGG - Intronic
948278670 2:236729487-236729509 TGGGTCTGCCAAGATCCTGCAGG - Intergenic
948796600 2:240406104-240406126 TGGGGCTGTGCAGAGGCTGTGGG - Intergenic
1171163923 20:22954280-22954302 TGTGGCTGTAAAAAGGCAGCAGG + Intergenic
1172407959 20:34703591-34703613 CGGGGCTGTAAAGAAGTGGCAGG - Intronic
1178416414 21:32408753-32408775 TGGAGCTGAAAAGAAGGTGCAGG + Intergenic
1179580169 21:42338483-42338505 TGGGGCGGGACAGATGCTGGAGG + Intergenic
1179902303 21:44400504-44400526 TGGGGCTGTAGAGATGGGGGTGG + Intronic
1180119453 21:45737081-45737103 TGGGGCAGTGAGGAGGCTGCGGG + Intronic
1184973426 22:48043816-48043838 TGTGACTGTATAGATCCTGCAGG + Intergenic
1185121692 22:48975192-48975214 AGGGGCTGTGCAGAAGCTGCTGG + Intergenic
1185336481 22:50272866-50272888 TGGGGCTGGGGAGAGGCTGCAGG - Intergenic
1185426618 22:50775373-50775395 TGGGACTGAGTAGATGCTGCGGG - Intronic
950097325 3:10337786-10337808 TGAGGCTGGACAGAAGCTGCAGG - Intronic
950565583 3:13767948-13767970 TGGGGCTGTGTGGATGCTGTCGG - Intergenic
950610726 3:14125098-14125120 TGGGGCTGGCAAGAGGCCGCTGG + Exonic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
950968243 3:17161441-17161463 AGGGGCTCACAAGATGCTGCTGG - Intronic
951463572 3:22977334-22977356 TGGGGCTGGAAAGTTGCTAAGGG + Intergenic
951710683 3:25582715-25582737 TGGGGCTGGAAGAGTGCTGCAGG - Intronic
952683993 3:36129327-36129349 TGTGGGTGTGAAGAGGCTGCTGG + Intergenic
954409841 3:50365657-50365679 TGAGGCCGTAGAGAAGCTGCTGG + Exonic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
956175556 3:66470236-66470258 TCGGGCTGGGAAGATACTGCCGG - Intronic
957068755 3:75548863-75548885 TTGGGATGTGAGGATGCTGCAGG - Intergenic
961426513 3:126852584-126852606 TGGTGCTGGAATGGTGCTGCAGG - Intronic
962453455 3:135541709-135541731 TGGGACTATTAAGATGCTCCAGG + Intergenic
963808629 3:149752435-149752457 TAGGACAGTGAAGATGCTGCTGG - Exonic
965158026 3:165089497-165089519 TGTGGCTGTAGAGATTCTGAGGG + Intergenic
966595816 3:181724012-181724034 TAGGGTCGTGAAGATGCTGCGGG + Intergenic
967870794 3:194227342-194227364 TGGGGCTCTAAAGGTGATGAGGG - Intergenic
967882701 3:194313207-194313229 TGGGGCTGGCAAGAGTCTGCGGG - Intergenic
969013083 4:4083400-4083422 TTGGGATGTGAGGATGCTGCAGG - Intergenic
969314483 4:6373236-6373258 TGGGGATGGAAGGATCCTGCAGG + Intronic
969740760 4:9024390-9024412 TTGGGATGTGAGGATGCTGCAGG + Intergenic
969800099 4:9557222-9557244 TTGGGATGTGAGGATGCTGCAGG + Intergenic
975575531 4:75858713-75858735 TGTGTCTGTAAAGATGTTTCTGG + Intergenic
980081725 4:128351251-128351273 TGAGGCTGGAAAGATACTCCAGG + Intergenic
980824463 4:138057111-138057133 TGCTGCTGGAAACATGCTGCAGG + Intergenic
981430709 4:144655922-144655944 TGGATCTGTAAATATTCTGCTGG - Intronic
982220874 4:153124208-153124230 TGGGGCTGGGAAGTGGCTGCCGG - Intergenic
985716393 5:1464356-1464378 TGGGGCTGGAAAGATGGTGCAGG + Intronic
989684438 5:44068756-44068778 TGTGGTTCTAAAGCTGCTGCTGG - Intergenic
991268441 5:64750013-64750035 TGGGGCTGTTAACCTGCAGCAGG - Intronic
992219377 5:74556755-74556777 TTGGGCTGTAATGATGGTGTGGG - Intergenic
992225891 5:74619439-74619461 TGAGGTTGTGTAGATGCTGCTGG - Intergenic
994202716 5:96996344-96996366 TGAGGCTGTAAATATCCTGTGGG + Intronic
994374854 5:99007787-99007809 TGGGGGTGGGAAGATGCTGTAGG + Intergenic
996456927 5:123695291-123695313 TGTGTCTGTAAAGATGTTTCTGG - Intergenic
999318951 5:150601431-150601453 TGGGGGAGAAAAGATGCAGCTGG + Intronic
1001945460 5:175774234-175774256 TGGAACTGTCAAGATGCTGGTGG - Intergenic
1003905510 6:10695527-10695549 TGGAGATGCAAAGATGCTGGAGG + Intronic
1004381581 6:15137368-15137390 TTGTGTTGTAAAGAAGCTGCTGG + Intergenic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1007229200 6:40336698-40336720 TGGGGGTGTAAGGATGCTCCTGG - Intergenic
1007260982 6:40562913-40562935 TGTGGCTCTCAAGAGGCTGCAGG + Intronic
1007314768 6:40978614-40978636 TGGGGGGGCCAAGATGCTGCTGG + Intergenic
1008897947 6:56579531-56579553 TGAGTCTGAAAAAATGCTGCTGG + Intronic
1011732025 6:90274630-90274652 TGTGGCTGCAAAGATGCAGCTGG - Intronic
1013185874 6:107757453-107757475 TGAGGATGTATAGAGGCTGCTGG + Intronic
1014198392 6:118583513-118583535 TGGGGCTGTAAAGATGCTGCAGG - Intronic
1015742134 6:136468053-136468075 TGGGGCTGTAGGGGTGGTGCTGG - Intronic
1018310913 6:162507489-162507511 TGAGGCTGTCAATATGGTGCTGG - Intronic
1018580372 6:165302791-165302813 TGGCTCTGTAGGGATGCTGCAGG - Intronic
1018739460 6:166716198-166716220 TGTGGCTTGAAATATGCTGCAGG - Intronic
1018769733 6:166959901-166959923 TGAGGTTTAAAAGATGCTGCTGG + Intergenic
1021164916 7:17325781-17325803 TGGGGCCGTTTAGAGGCTGCAGG + Intronic
1023173479 7:37412855-37412877 TGTGGCTGACAAGCTGCTGCTGG - Intronic
1026962655 7:74418318-74418340 CGGGGCTGTGAAGGTGCTCCTGG - Intergenic
1028902992 7:96121970-96121992 GGGGTCACTAAAGATGCTGCAGG + Exonic
1029071736 7:97905037-97905059 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1031115635 7:117665165-117665187 TGGGGCTATAAACATGCTTATGG - Intronic
1032965064 7:137086925-137086947 TAGGGCTGTAAGGAGCCTGCAGG + Intergenic
1033025357 7:137766857-137766879 TGGGGCTGTGCACCTGCTGCAGG - Intronic
1033945051 7:146706299-146706321 TTGGGCTATAAAGTTGCTGAGGG - Intronic
1036245965 8:7116957-7116979 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1036888305 8:12577070-12577092 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1038179013 8:25209106-25209128 AGGGTCTGTGAAGATGCCGCGGG + Intronic
1042823101 8:72953082-72953104 TGGTGCTGTAAAGTTGTTGCTGG - Intergenic
1043005395 8:74811878-74811900 TGGGGCTGGACATATGCTGGAGG + Intronic
1044381794 8:91542404-91542426 TGAGGCTGCACAGATGTTGCAGG + Intergenic
1044754107 8:95444086-95444108 TGGGGCTGTCAGGACGCCGCAGG - Intergenic
1045318448 8:101063286-101063308 TGTGGCATTAAAGTTGCTGCAGG - Intergenic
1045383907 8:101653023-101653045 TGGGGCTGTGGAAATGGTGCAGG + Intronic
1046168780 8:110477098-110477120 TAGGACTGTGAAGTTGCTGCTGG - Intergenic
1048512307 8:135073771-135073793 TGGGGCTGAGAAGGGGCTGCAGG - Intergenic
1050000459 9:1072002-1072024 TGTGGCTGTAGAGATGCAGGTGG + Intergenic
1053809944 9:41841957-41841979 TGGGGCTGGGTGGATGCTGCTGG - Intergenic
1054620649 9:67345471-67345493 TGGGGCTGGGTGGATGCTGCTGG + Intergenic
1055734031 9:79308842-79308864 GGAGGCTGTTAAGATGCTGGGGG - Intergenic
1055739697 9:79373467-79373489 TGTGTCTGTGAAGATGCTTCTGG - Intergenic
1056569340 9:87802243-87802265 TGAGGCTGTAAAGAGGCAGGAGG - Intergenic
1058938240 9:109789200-109789222 TGGGGCTGTCATGGTGTTGCTGG - Intronic
1058961425 9:109995914-109995936 TGAGGCAGGAAAGATACTGCAGG + Intronic
1059999002 9:119941615-119941637 TGCGGCTGCAAAGATGCCACAGG - Intergenic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1189997272 X:46651130-46651152 TGGGGCTGAAAACGTGCTTCTGG + Exonic
1190373008 X:49761105-49761127 TGGGGCCGCCAAGAAGCTGCAGG - Intergenic
1190512302 X:51185669-51185691 AGGGGCTGGAAAGAAGCTTCAGG - Intergenic
1193755972 X:85408903-85408925 TGGGGCAGACAAGGTGCTGCTGG - Intergenic
1194841577 X:98751121-98751143 TGCTGCTATAAAGATGCTACAGG + Intergenic
1198074746 X:133183620-133183642 TGGGCTTAGAAAGATGCTGCAGG + Intergenic
1198564101 X:137885563-137885585 TGGAACTGTAAGGATGGTGCAGG + Intergenic
1199030043 X:142986961-142986983 TGAAGCTGAGAAGATGCTGCTGG - Intergenic
1200166431 X:154038903-154038925 TGGAGGTGGAAGGATGCTGCAGG - Intronic