ID: 1014199728

View in Genome Browser
Species Human (GRCh38)
Location 6:118595166-118595188
Sequence GTAGCTATTTAATGGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014199726_1014199728 2 Left 1014199726 6:118595141-118595163 CCTCAAACTAATATCTGTGGCAA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1014199728 6:118595166-118595188 GTAGCTATTTAATGGCCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014199728 Original CRISPR GTAGCTATTTAATGGCCTCC AGG Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
913323748 1:117608100-117608122 GTAACAATTTAGAGGCCTCCTGG - Intronic
915140133 1:153762687-153762709 TAAGGCATTTAATGGCCTCCTGG - Intronic
915854156 1:159363212-159363234 GGAGCTCTAAAATGGCCTCCTGG + Intergenic
924492479 1:244552492-244552514 GTAGTCAATTAATGGCTTCCTGG + Exonic
1067974363 10:51007302-51007324 CTTGCTATTTAATGGTCTTCAGG - Intronic
1069578640 10:69549004-69549026 GTTGTCTTTTAATGGCCTCCAGG + Intergenic
1072269090 10:93757785-93757807 GTAACAATTAAAGGGCCTCCCGG + Intergenic
1080638187 11:34141715-34141737 GTAGCTATTTAATGAAGTTCAGG + Exonic
1083070946 11:59980615-59980637 GTGCCTGTTGAATGGCCTCCAGG + Intergenic
1086372781 11:86171605-86171627 GCAGCTATTTGATGGCCACTGGG - Intergenic
1089673661 11:120074357-120074379 GAAGCTCTTTCATGGCCACCAGG - Intergenic
1090031749 11:123212218-123212240 CTGGCTATTTCATGGTCTCCTGG + Intergenic
1090149765 11:124371080-124371102 GTAGCTATCTAATCTCCTCTAGG + Intergenic
1092456220 12:8645386-8645408 GTAGATATTGAATGCCCTCCTGG - Intronic
1093181530 12:15972456-15972478 GCAGCTGTTTAATGTGCTCCTGG + Intronic
1096237244 12:49937984-49938006 GCAGATATTAAATGCCCTCCTGG - Intergenic
1097968550 12:65607773-65607795 GCAGCTATTTCATTTCCTCCTGG + Intergenic
1098114886 12:67164610-67164632 ATAGCCATGTAATGGCTTCCAGG + Intergenic
1104164018 12:126208500-126208522 GTAGCTATTCAATGGTTTCCTGG - Intergenic
1105758516 13:23492081-23492103 GTAGCTATTTCACGGGCACCTGG - Intergenic
1107249068 13:38335575-38335597 GTACCTATTTAATGGCTGGCAGG + Intergenic
1110535643 13:76647775-76647797 GGAGCTATCTAAAGTCCTCCTGG - Intergenic
1114033369 14:18596165-18596187 TTAGCTAATTAATGGCTTCCTGG + Intergenic
1114078163 14:19175365-19175387 TTAGCTAATTAATGGCTTCCTGG + Intergenic
1114125331 14:19719188-19719210 TTAGCTAATTAATGGCTTCCTGG - Intronic
1122353716 14:101111580-101111602 GTTGCTATTTAAAGGCATCTTGG - Intergenic
1127202927 15:56677158-56677180 TTAGATTGTTAATGGCCTCCAGG + Intronic
1128913579 15:71539195-71539217 GTGGCTCTTTAATGGCTTCTTGG + Intronic
1129970386 15:79773229-79773251 GTAGAGATTTAGTGGCCTCTTGG + Intergenic
1134516267 16:14889631-14889653 GCAGATATTTAAAGGGCTCCTGG + Intronic
1134703939 16:16288283-16288305 GCAGATATTTAAAGGGCTCCTGG + Intronic
1134963604 16:18423831-18423853 GCAGATATTTAAAGGGCTCCTGG - Intronic
1134967899 16:18506430-18506452 GCAGATATTTAAAGGGCTCCTGG - Intronic
1140811886 16:78586318-78586340 GTAATTATTTCATGGCGTCCTGG - Intronic
1144020869 17:11239878-11239900 ATAGCTTTCTAATGGCCTCGAGG + Intergenic
1150266702 17:63836927-63836949 GAGGCTTTTTGATGGCCTCCTGG + Exonic
1153512708 18:5872944-5872966 GTCCCTCTTTCATGGCCTCCTGG - Intergenic
1161345619 19:3767529-3767551 AAAGCTCTTTATTGGCCTCCAGG - Exonic
1164250789 19:23473153-23473175 ATAGCTGTTTATTGGCCACCTGG + Intergenic
931826418 2:66005052-66005074 GTTGCTAATTAATGGCAACCAGG - Intergenic
937194633 2:120141813-120141835 CTTGCTTTTTAATGGCCTCAGGG + Intronic
943900068 2:193422434-193422456 CTAGATATTTAATGGCCTAATGG - Intergenic
1172268577 20:33638964-33638986 TTATTTATTTAATTGCCTCCTGG + Intronic
1180457484 22:15523220-15523242 TTAGCTAATTAATGGCTTCCTGG + Intergenic
950816470 3:15708280-15708302 GCAGTTATTTCATCGCCTCCAGG + Intronic
954946072 3:54425383-54425405 GCAGCTATTAAATGGCTACCTGG - Intronic
961345172 3:126259584-126259606 GTGCCTATCTAATGGCCTTCAGG + Intergenic
962659903 3:137591117-137591139 GGAGCTATTTAATGCCTTCAAGG - Intergenic
964123481 3:153210870-153210892 TTAGATATTTAATTGCCTCAGGG + Intergenic
964777699 3:160296215-160296237 ATATCTATTTAGTGGCTTCCAGG - Intronic
964873845 3:161343340-161343362 GGAGCTATATAATGTCCTCGTGG + Intergenic
967583348 3:191186098-191186120 GTAGCTTTTAAATGGCCAACAGG - Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
979201174 4:117980299-117980321 GTAGCTATTTGATGTGCTGCTGG - Intergenic
986903656 5:12467831-12467853 GGAGCTATATATGGGCCTCCAGG - Intergenic
987260022 5:16194050-16194072 GTTGATATTTAATGGCCACTGGG - Intergenic
987612804 5:20229124-20229146 GCAGCCATTTAATGTTCTCCAGG - Intronic
990548877 5:56852173-56852195 GTTGGTATTTAAGGGGCTCCAGG + Intronic
991906765 5:71521647-71521669 ATAGCTATCTAATGGTTTCCTGG - Intronic
994817945 5:104608769-104608791 GGAGCTATTTATTTGGCTCCTGG + Intergenic
994850689 5:105051597-105051619 GAAGCTTTTTAATGGGCTGCTGG + Intergenic
999961421 5:156760177-156760199 GAAGCTACTTAATGGCCTGATGG + Intronic
1004264353 6:14136021-14136043 AGAGCTATTTAATGGCCGGCTGG + Exonic
1004843575 6:19614065-19614087 TGAGCTTTTTATTGGCCTCCTGG - Intergenic
1011683396 6:89804429-89804451 GTAGCTTTTAAATGGAATCCAGG - Intronic
1014199728 6:118595166-118595188 GTAGCTATTTAATGGCCTCCAGG + Intronic
1022273086 7:28829457-28829479 TTAGCCATTTAATGACCTTCCGG - Intergenic
1028474231 7:91236080-91236102 GTAACTATTTAATGGCATGAGGG + Intergenic
1033682946 7:143614085-143614107 GTAACTTTTTAATGACCTTCAGG - Intergenic
1033701667 7:143843553-143843575 GTAACTTTTTAATGACCTTCAGG + Intergenic
1034054240 7:148018184-148018206 GTAGGTATTTAACGGACTCAGGG + Intronic
1035072070 7:156152972-156152994 GTTGCTATCTAATGGCCACCAGG - Intergenic
1035895985 8:3402515-3402537 GTATAAATTTTATGGCCTCCGGG - Intronic
1038908008 8:31928816-31928838 ATAGGTATTTAAAGGCATCCAGG + Intronic
1038975577 8:32692256-32692278 GTAGCTATTTTCTAGCCTGCTGG + Intronic
1041684970 8:60635414-60635436 TTAGCTATATAATGCCATCCAGG + Intergenic
1049330164 8:142046194-142046216 ATAGCTATTAAATTGCCTGCGGG + Intergenic
1051184224 9:14441803-14441825 GTATATATTTAATGGTCTCTGGG - Intergenic
1055952300 9:81741410-81741432 TTGGTTATCTAATGGCCTCCAGG - Intergenic
1058475310 9:105327161-105327183 GTAGAAATTTAGTAGCCTCCTGG + Intronic
1059396638 9:114038291-114038313 TTTGCATTTTAATGGCCTCCAGG - Intronic
1185937028 X:4269275-4269297 GTGGCTACTTAATGGGCTCAGGG + Intergenic
1189176323 X:38961080-38961102 GTAAATATTTAAGGGCCTCAAGG + Intergenic
1194123523 X:89988050-89988072 ATAACCATTTAATGGCCTCTAGG + Intergenic
1195474850 X:105274005-105274027 GTAGCTTTTTAATCACCACCAGG + Intronic
1197192470 X:123663154-123663176 GCAGCTTTATAATAGCCTCCAGG + Intronic
1199700432 X:150371484-150371506 TGAGCTAGTTAATGGCATCCAGG + Intronic
1200476408 Y:3645667-3645689 ATAACGATTTAATGGCCTCTAGG + Intergenic