ID: 1014202657

View in Genome Browser
Species Human (GRCh38)
Location 6:118622888-118622910
Sequence CCTTCCATGGGCACTTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014202657_1014202664 6 Left 1014202657 6:118622888-118622910 CCTTTAGAAGTGCCCATGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 213
Right 1014202664 6:118622917-118622939 AGTATGGAGCAACCCCCTCCAGG No data
1014202657_1014202665 9 Left 1014202657 6:118622888-118622910 CCTTTAGAAGTGCCCATGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 213
Right 1014202665 6:118622920-118622942 ATGGAGCAACCCCCTCCAGGAGG 0: 2
1: 0
2: 2
3: 7
4: 116
1014202657_1014202661 -10 Left 1014202657 6:118622888-118622910 CCTTTAGAAGTGCCCATGGAAGG 0: 1
1: 0
2: 4
3: 46
4: 213
Right 1014202661 6:118622901-118622923 CCATGGAAGGACCCTTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014202657 Original CRISPR CCTTCCATGGGCACTTCTAA AGG (reversed) Intronic
900405085 1:2489468-2489490 CCATCCATGGGCATATCTAGGGG + Intronic
903676069 1:25065432-25065454 TGTTCCATGGGCACATGTAATGG + Intergenic
905950745 1:41948563-41948585 CCTTCTATAAGCATTTCTAATGG - Intronic
907037529 1:51229529-51229551 CCTTCTATAAGCATTTCTAATGG - Intergenic
907415314 1:54310352-54310374 CCTTCCATAGAGATTTCTAAAGG + Intronic
908529565 1:65021398-65021420 CCTTCCATCGGCACTTCAGCAGG + Intergenic
908659381 1:66420913-66420935 CCTTCCATAGGTATTTCTAATGG + Intergenic
908808865 1:67958708-67958730 CCTTTCATGTGCACCTGTAATGG + Intergenic
909359233 1:74742526-74742548 CCTTCCGTAGGTATTTCTAATGG + Intronic
910591403 1:88930932-88930954 CCTTCTATAAGCATTTCTAATGG - Intergenic
910804852 1:91180173-91180195 CCTTCTATAAGCATTTCTAATGG - Intergenic
912463561 1:109853592-109853614 CCTTCTATAAGCATTTCTAATGG + Intergenic
913383040 1:118231006-118231028 CTTTCCATAGGTATTTCTAATGG - Intergenic
913468650 1:119169239-119169261 CCTTCTATAAGCATTTCTAATGG + Intergenic
913662014 1:121012703-121012725 ACTTCCATGGGATCTTCAAAGGG + Intergenic
914013388 1:143795888-143795910 ACTTCCATGGGATCTTCAAAGGG + Intergenic
914164437 1:145165297-145165319 ACTTCCATGGGATCTTCAAAGGG - Intergenic
914652012 1:149704497-149704519 ACTTCCATGGGATCTTCAAAGGG + Exonic
916607968 1:166361584-166361606 CCTTTCATGGGCACATCTCGTGG + Intergenic
917280326 1:173373335-173373357 CCTTCCATAGGTATTTCTAATGG - Intergenic
918280813 1:183003888-183003910 ACCTCCATGGCCTCTTCTAAAGG + Intergenic
920425074 1:205868583-205868605 CCTTCTATAAGCATTTCTAATGG + Intergenic
922684324 1:227627401-227627423 CCTTCTATAAGCATTTCTAATGG + Intronic
922792196 1:228316687-228316709 CCTTCCTTGGGCACATCTGCAGG + Exonic
1063870539 10:10412251-10412273 CCCTCCATGGGCATTTCTAGTGG + Intergenic
1064280862 10:13950460-13950482 CCTACCATAGGCACCTCTAGTGG - Intronic
1065199139 10:23297148-23297170 CCTTCTATAAGCATTTCTAATGG + Intronic
1065897908 10:30180900-30180922 CCTTCCATGGGCATTTTATATGG - Intergenic
1066614140 10:37279177-37279199 CCTTCCGTAGGTATTTCTAATGG + Intronic
1067713139 10:48666239-48666261 CCTTCCATAAGCATTTCTAATGG + Intergenic
1068791461 10:61035112-61035134 CCTTCTATAAGCATTTCTAATGG + Intergenic
1071326872 10:84526749-84526771 CCTTCTATAAGCATTTCTAACGG + Intergenic
1072371208 10:94767905-94767927 CCTTCCATAGGTATTTCTAATGG + Intronic
1072377749 10:94835500-94835522 CCTTCTATAAGCATTTCTAATGG + Intronic
1072471550 10:95718350-95718372 CCTTCTATAAGCATTTCTAATGG + Intronic
1076493441 10:130879839-130879861 CCTTCCCTGGGCACTGCTGCAGG + Intergenic
1077571656 11:3344743-3344765 CCTTCCATGTGGATTTCCAAGGG - Intronic
1079887285 11:26004014-26004036 CCTTCTATAAGCATTTCTAATGG - Intergenic
1079933587 11:26592960-26592982 CCTTCTATAAGCATTTCTAATGG + Intronic
1081070708 11:38605822-38605844 CCTTCTATAAGCATTTCTAATGG - Intergenic
1084273700 11:68041511-68041533 CCTGCCATGGGCACTGCTCATGG + Intronic
1085569698 11:77548571-77548593 CCTTCCCTAGGTATTTCTAAGGG + Intronic
1086053996 11:82626804-82626826 CCTTCCATAGGTATTTCTAATGG - Intergenic
1086451205 11:86918919-86918941 CCTTCCATGGTGGCTTCTACTGG - Intronic
1086927651 11:92657514-92657536 CCTTCGATGGGCACTGTGAAAGG + Intronic
1087682896 11:101235197-101235219 CCTTCCATAGGTATTTCTAATGG + Intergenic
1088383512 11:109222928-109222950 CCTGCCATGGCCACTTCTCCAGG - Intergenic
1091081359 11:132671693-132671715 CCTTCCATAGAAACTTGTAAGGG + Intronic
1091994274 12:4980927-4980949 CCTTCCATGAGCAATTTTACTGG - Intergenic
1092469093 12:8762397-8762419 CCTTCTATAAGCATTTCTAATGG + Intronic
1095125661 12:38473463-38473485 CCTTCTATAAGCATTTCTAATGG - Intergenic
1096351714 12:50906168-50906190 CCTTCTATAAGCATTTCTAATGG + Intergenic
1097325003 12:58266479-58266501 TCTTCCATGGGCTCTTCACAAGG - Intergenic
1099376691 12:81901890-81901912 CTTTCCATAGGTATTTCTAATGG - Intergenic
1100210245 12:92392048-92392070 CCTTCCATAGGTATTTCTAATGG - Intergenic
1100308246 12:93370992-93371014 CCTTCCCTGGGCACTGCTCCCGG - Intergenic
1100402031 12:94240238-94240260 CCTTCCTTTCCCACTTCTAAGGG + Intronic
1100529771 12:95452553-95452575 CCTTCCATAGGTATTTCTAATGG + Intergenic
1101780396 12:107829648-107829670 CCTTCCATGGGTATTTCTGGAGG + Intergenic
1103775440 12:123364033-123364055 CCCTCCATGGGTAATTCTTAGGG + Intronic
1103803477 12:123554941-123554963 CCTTCTATAAGCATTTCTAATGG - Intergenic
1104306608 12:127615689-127615711 CCTTCCCTTGGTATTTCTAATGG - Intergenic
1105642953 13:22285075-22285097 CCTGCCCTGGGCACTGCTCATGG - Intergenic
1107137084 13:36956882-36956904 CCTTCTATAAGCATTTCTAATGG - Intronic
1109424881 13:62155720-62155742 CCTTCCATAGGTATTTCTAATGG - Intergenic
1113551035 13:111193305-111193327 CCTTCCGTAGGTATTTCTAATGG + Intronic
1116697805 14:48199938-48199960 CCTTCCGTAGGTATTTCTAATGG - Intergenic
1117158532 14:52964605-52964627 CCTTCAAGGGGCTCTTATAATGG - Intergenic
1120739927 14:88096818-88096840 CCCTCCATGGGACCTTCTTAAGG + Intergenic
1121097309 14:91226598-91226620 CCTTCTATAAGCATTTCTAATGG + Intergenic
1121545149 14:94757777-94757799 CCTGCCATGCGCACATCTCATGG + Intergenic
1121640383 14:95481285-95481307 CCTCCCAGGGGCAGTTCTATTGG - Intergenic
1124238801 15:28013348-28013370 CCAGCCAAGGGCCCTTCTAAAGG - Intronic
1124955264 15:34356118-34356140 CCTTCCCAGGGCACTGCTAAAGG - Exonic
1126070968 15:44864426-44864448 CCTTCCATAGGTATTTCTAATGG + Intergenic
1130160381 15:81393068-81393090 GCTTCCATGTTCACTTCCAAAGG - Intergenic
1131411410 15:92210962-92210984 CCTTCCATAGGTATTTCTAATGG - Intergenic
1131917729 15:97288763-97288785 CCTTCTGTGAGCACTTCAAAGGG + Intergenic
1132234493 15:100208972-100208994 CCTTCCAAGGGCTCTTCCAATGG + Intronic
1132249004 15:100319301-100319323 GCTTCCCTGGGAATTTCTAATGG - Intronic
1133508405 16:6434136-6434158 CCGTGCCTGGTCACTTCTAAGGG + Intronic
1135222391 16:20624095-20624117 CCTTCCTTGGGTACTTGTATGGG + Exonic
1140738572 16:77921406-77921428 TCTTCCATGGGTTCTCCTAAAGG - Intronic
1144733779 17:17543439-17543461 CCTTCCGTGGCCCCTTCAAAGGG - Intronic
1145804542 17:27717166-27717188 CCTTCCATAGGTATTTCTAATGG - Intergenic
1146997414 17:37333425-37333447 CCTTCTATAAGCATTTCTAATGG - Intronic
1148070878 17:44907868-44907890 CCCTCCATAGGCTGTTCTAAGGG - Intronic
1149074335 17:52578617-52578639 CCTTCCATAGGTATTTCTAATGG - Intergenic
1149213686 17:54330595-54330617 CCTTCCATAGGTATTTCTAATGG - Intergenic
1149273726 17:55012360-55012382 CCTTCTATAAGCATTTCTAATGG + Intronic
1152659942 17:81537464-81537486 CCTTCCTTGTGCACTGCTCAAGG + Intergenic
1154360538 18:13656873-13656895 CCTTCTATAAGCATTTCTAATGG - Intergenic
1154938563 18:21087861-21087883 AGTTCCATGAGCACTTGTAAAGG - Intronic
1158548431 18:58415164-58415186 TCTGCCATGAGCACCTCTAAAGG + Intergenic
1158686803 18:59622123-59622145 TCTTCCATGGCCACCTCCAAGGG + Intronic
1158786033 18:60712751-60712773 CCTTCTATAAGCATTTCTAATGG - Intergenic
1164173913 19:22751111-22751133 CCTTCTATAAGCATTTCTAATGG - Intergenic
1164204661 19:23048140-23048162 CCCTGCATGGGCCCTGCTAAGGG + Intergenic
1164299314 19:23947189-23947211 CCTTCTATAAGCATTTCTAATGG - Intergenic
1165667781 19:37648498-37648520 CCTCCCATGGGTGCTTATAATGG + Intronic
1166165824 19:40987645-40987667 CCTTCTATAAGCATTTCTAATGG + Intergenic
1166432963 19:42741971-42741993 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166436069 19:42767197-42767219 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166445951 19:42857225-42857247 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166448931 19:42881185-42881207 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166453330 19:42919376-42919398 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166455815 19:42938684-42938706 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166465608 19:43027960-43027982 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166471750 19:43084164-43084186 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166482886 19:43187980-43188002 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166485369 19:43207113-43207135 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166492515 19:43271032-43271054 CCTTCCCTGGGCCCAGCTAAAGG - Intergenic
924973779 2:154918-154940 CCTTCTATAAGCATTTCTAATGG + Intergenic
926270717 2:11364017-11364039 CCTTTCATGGGGACGTGTAATGG + Intergenic
926864835 2:17345295-17345317 CCTTCTATAAGCATTTCTAATGG - Intergenic
927854686 2:26520593-26520615 GCTTCCATGGGCTGCTCTAAGGG - Intronic
928677456 2:33663509-33663531 CCTTCTATAAGCATTTCTAATGG - Intergenic
932918031 2:75878091-75878113 CCTTCTATAAGCATTTCTAATGG - Intergenic
933486773 2:82934060-82934082 CTTTTCATTGGCACTTCAAAAGG - Intergenic
934088404 2:88529489-88529511 CCTTCCAAAGGCTCTTCCAAGGG + Exonic
934671735 2:96218119-96218141 CCTTCTATAAGCATTTCTAATGG + Intergenic
936715627 2:115183914-115183936 CTTTCCATGGACACTTTTAGAGG - Intronic
936802498 2:116285436-116285458 CCTTCTATAGGTATTTCTAATGG - Intergenic
942761033 2:179398437-179398459 CCTTCCAGGCGCCCTTCCAAAGG - Intergenic
942939194 2:181597489-181597511 CTTCCCATGGGCACTCCAAAAGG - Intronic
946129112 2:217591791-217591813 CCTTCTATAAGCATTTCTAATGG + Intronic
946206359 2:218111730-218111752 CCTTCCATAGGTATTTCTAATGG + Intergenic
947546578 2:231014840-231014862 CCTTCAGTGGGCTCTTGTAATGG + Intronic
948580160 2:238981624-238981646 CCTTCTATAAGCATTTCTAATGG + Intergenic
1168741034 20:191637-191659 CCTTCTATAAGCATTTCTAATGG + Intergenic
1174984609 20:55436657-55436679 CCTTCCATGGTCACCACTACAGG + Intergenic
1175319668 20:58076419-58076441 CCTTCCCTTGGAACTTCCAAGGG + Intergenic
1177135490 21:17302287-17302309 CCTTCCATAGGTATTTCTAATGG - Intergenic
1177263164 21:18754134-18754156 CCTTCTATAAGCATTTCTAATGG + Intergenic
1178666616 21:34552827-34552849 CCCTCCATGGGCAATTTTAGTGG + Intronic
1179258770 21:39740204-39740226 CCTTCTATAAGCATTTCTAATGG + Intergenic
1179266625 21:39809475-39809497 CCTTACATGGGAACTTTTCATGG + Intergenic
1183876696 22:40788970-40788992 CCTTCAAAGAGCACTTCTATGGG - Intronic
949338467 3:3003174-3003196 CCTTCCTGGGAGACTTCTAAGGG + Intronic
949539574 3:5021362-5021384 CTTTCTTTGGGCACTTCAAAAGG - Intergenic
951705954 3:25544741-25544763 CCTTCCCTGAGCACTTTCAACGG + Intronic
953085219 3:39659110-39659132 CCTTCTATAAGCATTTCTAATGG - Intergenic
954231910 3:49224261-49224283 CCTTCCGTAGGTATTTCTAATGG + Intronic
955787088 3:62552103-62552125 TTTTCCATGGGCAGTTCTCAAGG + Intronic
956247658 3:67202569-67202591 TCTTCCTTGAGCACTTCCAATGG + Intergenic
956999919 3:74873776-74873798 CCTTCTATAAGCATTTCTAATGG + Intergenic
957368126 3:79253283-79253305 CTTTCCTTGGGGTCTTCTAATGG - Intronic
960539602 3:118848768-118848790 CCCTCTATGGGCACTTCTAATGG - Intergenic
961991610 3:131197815-131197837 CCTTCTATAAGCATTTCTAATGG + Intronic
962990294 3:140571970-140571992 CCTTCACTGGGCACTTGTGATGG + Exonic
963188330 3:142442374-142442396 CCTTCTATAAGCATTTCTAATGG - Intronic
964272949 3:154978341-154978363 CCTTCTATAAGCATTTCTAATGG - Intergenic
964916557 3:161848307-161848329 CCTTCCATGGGCATGTCTGAAGG + Intergenic
965054434 3:163695858-163695880 CCTTCTATAAGCATTTCTAAAGG + Intergenic
965063164 3:163807033-163807055 CCTTCCATAGGTATTTCTAAGGG - Intergenic
966353926 3:179059187-179059209 CCTTCTATAAGCATTTCTAATGG - Intronic
967186493 3:186948879-186948901 CATTCCATGAGGACTCCTAAGGG - Intronic
969645330 4:8425263-8425285 CCTTCTATAAGCATTTCTAATGG - Intronic
971980209 4:33741920-33741942 CCTTCTATAAGCATTTCTAATGG - Intergenic
972052560 4:34757188-34757210 CCTTCCATTGCTACTGCTAATGG + Intergenic
972179137 4:36442610-36442632 CCTTCTATAAGCATTTCTAATGG + Intergenic
972574858 4:40342403-40342425 CCTTCCATGAGTAGTTCTATAGG - Intronic
972780988 4:42286756-42286778 CCTTCTATAAGCATTTCTAATGG + Intergenic
974762038 4:66289634-66289656 GCTTCCATCAGCACTACTAAGGG + Intergenic
975332986 4:73140302-73140324 CCATTCATGTGCACTTCTGAGGG - Intronic
976464588 4:85353071-85353093 CCTTCTATAAGCATTTCTAATGG + Intergenic
977884603 4:102241551-102241573 CCTTCCGTAGGTATTTCTAATGG - Intergenic
978586429 4:110280149-110280171 CCTTCTATAAGCATTTCTAATGG + Intergenic
980290473 4:130843763-130843785 CCTTCCATAGTTATTTCTAATGG + Intergenic
980444587 4:132888161-132888183 CCTTCTATAAGCATTTCTAATGG - Intergenic
980883054 4:138732848-138732870 CTTTCCATTGCCATTTCTAATGG - Intergenic
981586435 4:146308246-146308268 CCTTTCAGAGCCACTTCTAAGGG - Intronic
984939508 4:184918868-184918890 CCTTCCGTAGGTATTTCTAATGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
988956944 5:36329639-36329661 CCTTCTATAAGCATTTCTAATGG + Intergenic
990118636 5:52421625-52421647 CCTTCCATCATCTCTTCTAATGG - Intergenic
994231313 5:97312819-97312841 CCTTCCATAGGTATTTCTAATGG + Intergenic
995126099 5:108578095-108578117 CCTTCTATAAGCATTTCTAATGG + Intergenic
995466006 5:112450083-112450105 CCTTCTATAAGCATTTCTAATGG - Intergenic
995543785 5:113209730-113209752 CCTTCCATGGCCATTCCTACAGG + Intronic
997959740 5:138310812-138310834 CCTTCAATAGGGACTTCGAATGG + Intronic
998111889 5:139508789-139508811 CCTTCCCTAGGTATTTCTAATGG - Intergenic
998713430 5:144851380-144851402 CCTTCCATAGGTATTTCTAATGG + Intergenic
999990937 5:157049244-157049266 CTTTCCATGGGCCCTTCTCCTGG + Intronic
1000811519 5:165868739-165868761 CCAAAGATGGGCACTTCTAAAGG - Intergenic
1001064199 5:168522755-168522777 CCTTCCACTGGCACTTCACAGGG + Intergenic
1003359625 6:5412308-5412330 CCCTCCATGGGCCATTCTGATGG + Intronic
1003746086 6:9004250-9004272 CCTTCTCTGGGCACATTTAAAGG - Intergenic
1004048311 6:12047731-12047753 CGTTTCTTAGGCACTTCTAAGGG + Intronic
1004236964 6:13882756-13882778 CCTTCTATAAGCATTTCTAATGG - Intergenic
1004531795 6:16461151-16461173 CCTTCCATAGGTATTTCTAATGG - Intronic
1009385547 6:63081333-63081355 CCTCCCATGGGAATTTCTAATGG + Intergenic
1009545152 6:65011000-65011022 CCTTCTATAAGCATTTCTAATGG - Intronic
1011209884 6:84944343-84944365 CCTTCTATAAGCATTTCTAATGG - Intergenic
1011539483 6:88415128-88415150 CCTTCTATAAGCATTTCTAATGG + Intergenic
1013907424 6:115235691-115235713 CCTTCCATAGGTATTTCTAATGG + Intergenic
1014202657 6:118622888-118622910 CCTTCCATGGGCACTTCTAAAGG - Intronic
1016444338 6:144117271-144117293 CCTTCTATAAGCAGTTCTAATGG + Intergenic
1017101382 6:150852506-150852528 CCTTCCATAGGTATTTCTAATGG - Intergenic
1018579405 6:165295800-165295822 CCTTCACTGGACATTTCTAAAGG + Intronic
1018756927 6:166857915-166857937 CCTGGCATGGGCACTTGTGAGGG - Intronic
1018761417 6:166897289-166897311 CCTTCTATAAGCATTTCTAATGG - Intronic
1019078680 6:169412426-169412448 CCTTCTATTGGCACCTCTTAAGG + Intergenic
1019404046 7:873685-873707 CCTTGCACTGGCTCTTCTAAAGG + Exonic
1021521303 7:21542146-21542168 CCTTCCATGGGGGCTACTGAAGG - Intergenic
1023439155 7:40168857-40168879 CCTTCTATAAGCATTTCTAATGG + Intronic
1024870372 7:53957242-53957264 CCTTCCATAGATATTTCTAATGG + Intergenic
1025610342 7:63071854-63071876 CCTTCCATGGGCACTACCTGAGG + Intergenic
1027148139 7:75713111-75713133 CCTTCCAAGGGCCCTTTTCAGGG - Intronic
1027791393 7:82641619-82641641 CCTTCCACAGGTATTTCTAATGG - Intergenic
1027987851 7:85317706-85317728 TCTTGCATGTGCCCTTCTAAGGG + Intergenic
1030337674 7:108343507-108343529 CCTTCTATAAGCATTTCTAATGG - Intronic
1030843129 7:114380034-114380056 CCTTCTATAAGCATTTCTAATGG + Intronic
1031264926 7:119569873-119569895 CCTTCTATAAGCATTTCTAATGG - Intergenic
1031471677 7:122175039-122175061 CCTTCTATAAGCATTTCTAATGG - Intergenic
1034249338 7:149675800-149675822 CCTTCTATAAGCATTTCTAATGG - Intergenic
1038430378 8:27494963-27494985 CCTTCCGTAGGTATTTCTAATGG + Intronic
1039692767 8:39880028-39880050 CCTTCCATAGGTATTTCTAATGG + Intergenic
1039999272 8:42562686-42562708 CCTTCCGTAGGTATTTCTAATGG + Intergenic
1040649357 8:49431624-49431646 CCTTCCATAGGTATTTCTAATGG - Intergenic
1040796428 8:51293807-51293829 CCTTCCATAGGTATTTCTAACGG + Intergenic
1041002329 8:53465049-53465071 CCTTCCGTAGGTATTTCTAATGG - Intergenic
1041663498 8:60421240-60421262 CCTTCTATAAGCATTTCTAATGG + Intergenic
1041867747 8:62596296-62596318 CCTTCTATAAGCATTTCTAATGG + Intronic
1042056260 8:64767395-64767417 CCTTCTATAAGCATTTCTAATGG - Intronic
1042364634 8:67922664-67922686 CCTTCTATAAGCATTTCTAATGG - Intergenic
1042920020 8:73911454-73911476 CCTTCCGTAGGTATTTCTAATGG - Intergenic
1043490337 8:80742218-80742240 CCTTCTATAAGCATTTCTAATGG - Intronic
1044005046 8:86929049-86929071 CCTTCCATAGGTATTTCTAATGG + Intronic
1044095547 8:88059672-88059694 CCTTCCATCGTCCCTTCTAAAGG + Intronic
1045928936 8:107601296-107601318 CCTTCCATGGGCATTTCTGAAGG + Intergenic
1045960345 8:107960679-107960701 CATTCCATGGTTTCTTCTAATGG + Exonic
1046789009 8:118300430-118300452 CCTTTCCTGGGCACCTCTGAAGG - Intronic
1048005635 8:130417372-130417394 CCTTCCAGGGGCCCTTCCAAAGG + Intronic
1052057373 9:23920405-23920427 CCTTCCATAGGTATTTCTAATGG + Intergenic
1053134490 9:35641689-35641711 CCTTCTATAAGCATTTCTAATGG + Intronic
1056392365 9:86151816-86151838 CCTTCCATAGCTATTTCTAATGG + Intergenic
1062186348 9:135220619-135220641 GCCTCCATGGGCCCTTCTTATGG + Intergenic
1186308678 X:8292955-8292977 CAATCCAAGGTCACTTCTAATGG + Intergenic
1189946679 X:46187470-46187492 CCTTCTATAAGCATTTCTAATGG - Intergenic
1192545973 X:72014718-72014740 TATTCCATGGGCACTTGAAAAGG + Intergenic
1193307056 X:79962129-79962151 CCTTCTATAAGCATTTCTAATGG - Intergenic
1195535321 X:106003162-106003184 CCTTCTATAAGCATTTCTAATGG - Intergenic
1196489149 X:116247170-116247192 CCTTCCATAGGTATTTCTAATGG - Intergenic
1196661936 X:118279248-118279270 CCTTCCATAGGTATTTCTAATGG + Intergenic
1197073246 X:122325727-122325749 CTTTCCATGGGCAATCCAAACGG - Intergenic
1197513802 X:127400482-127400504 CCTTCCATAGGTACTTCTAATGG - Intergenic
1199529455 X:148830414-148830436 CCCTCCATGGGCCCATCTATTGG + Intronic
1199813395 X:151373152-151373174 TCTTCAATGGGCTCTTTTAATGG + Intergenic
1200959671 Y:8985330-8985352 CCTTCCATAGGTATTTCTAATGG - Intergenic
1201407164 Y:13660909-13660931 CTTTCCGTAGGTACTTCTAATGG + Intergenic
1201455502 Y:14163705-14163727 ACTTCCATGGGTATTTCTAATGG - Intergenic
1201496233 Y:14593638-14593660 CCTTCCATAGGCATTTCTAATGG + Intronic
1201515606 Y:14816283-14816305 CCTTCCACAGGTACTTCTAATGG + Intronic
1201530882 Y:14988763-14988785 CCTTCCATAAATACTTCTAATGG - Intergenic
1201631626 Y:16076695-16076717 CCTTCCATAGGTTTTTCTAATGG - Intergenic
1201639895 Y:16167406-16167428 CCTTCCTTGGGCATTTCTGAAGG + Intergenic
1201662918 Y:16417919-16417941 CCTTCCTTGGGCATTTCTGAAGG - Intergenic
1201723968 Y:17134058-17134080 CCTTCTATAAGCATTTCTAATGG + Intergenic
1201905979 Y:19086113-19086135 CCTTCCATAAGCATTTCTAATGG - Intergenic
1201911398 Y:19136911-19136933 GCTTCCATAGGTATTTCTAATGG - Intergenic
1202243253 Y:22791617-22791639 CCTTCCATAGGTATTTCTAAAGG - Intergenic
1202396240 Y:24425367-24425389 CCTTCCATAGGTATTTCTAAAGG - Intergenic
1202474544 Y:25244725-25244747 CCTTCCATAGGTATTTCTAAAGG + Intergenic