ID: 1014205868

View in Genome Browser
Species Human (GRCh38)
Location 6:118654773-118654795
Sequence TGCCTCACAGGATTGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1953
Summary {0: 2, 1: 7, 2: 73, 3: 405, 4: 1466}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014205862_1014205868 11 Left 1014205862 6:118654739-118654761 CCCTTACCTGTAAATTGGGGATT 0: 1
1: 0
2: 2
3: 71
4: 364
Right 1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG 0: 2
1: 7
2: 73
3: 405
4: 1466
1014205863_1014205868 10 Left 1014205863 6:118654740-118654762 CCTTACCTGTAAATTGGGGATTA 0: 1
1: 1
2: 43
3: 348
4: 2096
Right 1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG 0: 2
1: 7
2: 73
3: 405
4: 1466
1014205864_1014205868 5 Left 1014205864 6:118654745-118654767 CCTGTAAATTGGGGATTATAATG 0: 1
1: 1
2: 22
3: 157
4: 738
Right 1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG 0: 2
1: 7
2: 73
3: 405
4: 1466
1014205857_1014205868 25 Left 1014205857 6:118654725-118654747 CCTGTGCCTCAATTCCCTTACCT 0: 1
1: 2
2: 9
3: 133
4: 770
Right 1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG 0: 2
1: 7
2: 73
3: 405
4: 1466
1014205858_1014205868 19 Left 1014205858 6:118654731-118654753 CCTCAATTCCCTTACCTGTAAAT No data
Right 1014205868 6:118654773-118654795 TGCCTCACAGGATTGCTGTGGGG 0: 2
1: 7
2: 73
3: 405
4: 1466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014205868 Original CRISPR TGCCTCACAGGATTGCTGTG GGG Intronic