ID: 1014213059

View in Genome Browser
Species Human (GRCh38)
Location 6:118727004-118727026
Sequence GACTCAAATGTGCCATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014213057_1014213059 22 Left 1014213057 6:118726959-118726981 CCAGACTGATTTAAAAAAAAAAA No data
Right 1014213059 6:118727004-118727026 GACTCAAATGTGCCATGGTTTGG No data
1014213056_1014213059 23 Left 1014213056 6:118726958-118726980 CCCAGACTGATTTAAAAAAAAAA No data
Right 1014213059 6:118727004-118727026 GACTCAAATGTGCCATGGTTTGG No data
1014213055_1014213059 28 Left 1014213055 6:118726953-118726975 CCATGCCCAGACTGATTTAAAAA No data
Right 1014213059 6:118727004-118727026 GACTCAAATGTGCCATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014213059 Original CRISPR GACTCAAATGTGCCATGGTT TGG Intergenic
No off target data available for this crispr