ID: 1014215693

View in Genome Browser
Species Human (GRCh38)
Location 6:118750749-118750771
Sequence AGTCAGTGGCGTGCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014215691_1014215693 -1 Left 1014215691 6:118750727-118750749 CCGGGAGCTGGGGGTGGGTTGCA No data
Right 1014215693 6:118750749-118750771 AGTCAGTGGCGTGCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014215693 Original CRISPR AGTCAGTGGCGTGCAGCAGC TGG Intergenic
No off target data available for this crispr