ID: 1014230376

View in Genome Browser
Species Human (GRCh38)
Location 6:118895275-118895297
Sequence GCGCCGGGATGCTGGCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014230365_1014230376 5 Left 1014230365 6:118895247-118895269 CCGGTCCTCCTCGGCCGGCGCCC 0: 1
1: 0
2: 4
3: 20
4: 231
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230362_1014230376 14 Left 1014230362 6:118895238-118895260 CCTGTTCGGCCGGTCCTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230368_1014230376 0 Left 1014230368 6:118895252-118895274 CCTCCTCGGCCGGCGCCCGGGAT 0: 1
1: 0
2: 0
3: 22
4: 120
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230357_1014230376 30 Left 1014230357 6:118895222-118895244 CCCGGGGGCCGTGGGTCCTGTTC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230372_1014230376 -9 Left 1014230372 6:118895261-118895283 CCGGCGCCCGGGATGCGCCGGGA 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230361_1014230376 22 Left 1014230361 6:118895230-118895252 CCGTGGGTCCTGTTCGGCCGGTC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230369_1014230376 -3 Left 1014230369 6:118895255-118895277 CCTCGGCCGGCGCCCGGGATGCG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data
1014230358_1014230376 29 Left 1014230358 6:118895223-118895245 CCGGGGGCCGTGGGTCCTGTTCG 0: 1
1: 0
2: 0
3: 11
4: 271
Right 1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014230376 Original CRISPR GCGCCGGGATGCTGGCGCGC AGG Intronic
No off target data available for this crispr