ID: 1014233979

View in Genome Browser
Species Human (GRCh38)
Location 6:118935031-118935053
Sequence CCGCGCGTCCCCGCGGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014233979_1014233986 -9 Left 1014233979 6:118935031-118935053 CCACCGGCCGCGGGGACGCGCGG 0: 1
1: 0
2: 4
3: 25
4: 206
Right 1014233986 6:118935045-118935067 GACGCGCGGGCTGTGTCGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 60
1014233979_1014233990 15 Left 1014233979 6:118935031-118935053 CCACCGGCCGCGGGGACGCGCGG 0: 1
1: 0
2: 4
3: 25
4: 206
Right 1014233990 6:118935069-118935091 CTAGCGCCTGCGGCTCTGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 144
1014233979_1014233987 5 Left 1014233979 6:118935031-118935053 CCACCGGCCGCGGGGACGCGCGG 0: 1
1: 0
2: 4
3: 25
4: 206
Right 1014233987 6:118935059-118935081 GTCGGGCGGCCTAGCGCCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 42
1014233979_1014233989 14 Left 1014233979 6:118935031-118935053 CCACCGGCCGCGGGGACGCGCGG 0: 1
1: 0
2: 4
3: 25
4: 206
Right 1014233989 6:118935068-118935090 CCTAGCGCCTGCGGCTCTGCCGG 0: 1
1: 0
2: 1
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014233979 Original CRISPR CCGCGCGTCCCCGCGGCCGG TGG (reversed) Exonic
900109607 1:999982-1000004 CCGCGCCTCCCCGTGCCGGGTGG + Exonic
900204937 1:1427707-1427729 CCGGGGGTCCCAGCGGGCGGAGG - Exonic
901238573 1:7680286-7680308 CCTCCCGTCCCCGCGGGCGCTGG + Intronic
901934699 1:12619224-12619246 CTGCACGTTCCCGGGGCCGGAGG + Intergenic
902286118 1:15409804-15409826 CCGCGCGGGCCCGGGGGCGGGGG + Intergenic
903349750 1:22710711-22710733 GCGCGCGTCCCGGCCCCCGGCGG - Intergenic
903349830 1:22710943-22710965 CCCCGCGGCGCCGCGGCCCGAGG + Intronic
904237631 1:29124804-29124826 CCGGGGGTCTCCACGGCCGGGGG - Intergenic
905793417 1:40802288-40802310 CGCCGCGTCCCCGAGGCCAGGGG - Intronic
905819848 1:40980408-40980430 CCTCCCTTCCCGGCGGCCGGGGG + Intronic
907261285 1:53220536-53220558 CTCCGTGTCCCCGCGGCGGGCGG + Intronic
908272689 1:62436580-62436602 CCGCGCCTCCCACCGCCCGGGGG - Intronic
908360892 1:63367657-63367679 GCGCGAATCCCAGCGGCCGGCGG + Exonic
910138360 1:83998957-83998979 CCTCGCGTCCCCGCTGCAAGCGG + Exonic
912492620 1:110070472-110070494 CCGCGCCGCCCCGCGGCCCGCGG - Exonic
917974255 1:180229403-180229425 GCGCGCGTCCCCGCAGACCGCGG - Intergenic
920027229 1:203007653-203007675 GCTCGCGTGCCCGCGGCTGGAGG + Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
921671098 1:217925039-217925061 CTCCGTGTGCCCGCGGCCGGCGG + Intergenic
921945045 1:220880302-220880324 ACTCGCGTCCCCGAGGCCGGGGG - Exonic
922307581 1:224357296-224357318 CCGCTCGTCCCCGCGGCGCCCGG + Intronic
922753535 1:228082155-228082177 CCGCGCGTCACTGCGGCCGCCGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923141076 1:231162152-231162174 CCGCGCGACGCTGCAGCCGGCGG - Intronic
1062843636 10:689253-689275 CCGCGATTCCCCGCGCCCTGGGG - Intronic
1063929840 10:11018026-11018048 GCGCGCGTCCGAGCGGCCGCGGG - Exonic
1063995180 10:11611831-11611853 GCGCGCGTCCCCGAGGCGGGCGG - Intergenic
1064397422 10:14992895-14992917 CCACGCGTCCCCGAGGATGGTGG + Intergenic
1066402614 10:35090365-35090387 CCCCGCGTCTCCGGGGCCGGTGG - Intronic
1067110637 10:43397201-43397223 CCGCGCCTCCTCGGGGCCGACGG - Intronic
1072139035 10:92573788-92573810 CCGCCCGTCCCGCCGGCCTGGGG - Intronic
1072151748 10:92689875-92689897 CGGCCCCACCCCGCGGCCGGCGG + Intergenic
1076435907 10:130441142-130441164 CGGCGCATCCCTCCGGCCGGCGG - Intergenic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1077074806 11:695532-695554 TCGCCCGTTCCCGCCGCCGGCGG + Exonic
1080383927 11:31799337-31799359 CAGCGCGGCCGCTCGGCCGGCGG - Intronic
1081528614 11:43943280-43943302 GCGCGCGTCCCCCCCGCGGGCGG - Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1083883200 11:65558309-65558331 CCCTGCCTCCCCGCGGCCGCGGG - Intronic
1083922308 11:65787490-65787512 CCGCGGGTGCCCCAGGCCGGAGG - Intronic
1083970410 11:66070737-66070759 CCGCGCCTCCCGGTGGCCCGGGG + Exonic
1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG + Intronic
1085207642 11:74746167-74746189 CCGCGCGACTCGGCGGCAGGAGG + Intergenic
1089729439 11:120511468-120511490 GCGCGGGTCCGCGCGGCCGGGGG - Intergenic
1091888095 12:4031312-4031334 CCGCGCCTCCCCGCGCCCGGCGG + Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096994338 12:55829595-55829617 CCTTCCGTCCCCGCGGCCGCCGG + Exonic
1097925435 12:65121610-65121632 CCTCGCGGCCCCGCCCCCGGGGG - Intergenic
1103905508 12:124325490-124325512 CCGGGCCTCCCCGCGGGCAGCGG - Exonic
1104935444 12:132361731-132361753 CGGAGCGTCCCCGCTGCCTGGGG - Intergenic
1107468026 13:40666651-40666673 GCGCGCGCCGCCGCGGGCGGGGG - Intergenic
1107604042 13:42040845-42040867 CTGCGCGCCCGGGCGGCCGGCGG + Intronic
1110436461 13:75482095-75482117 CCGAGGGTCCCCGCGGCCGCCGG + Exonic
1116457271 14:45134230-45134252 CCTCGTCTTCCCGCGGCCGGTGG - Intronic
1116467688 14:45252978-45253000 CCGCGGGTCCCCGCAGATGGTGG - Intronic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1118925823 14:70188925-70188947 CCGCGCGTCCCCTCTGCGCGCGG - Exonic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119487717 14:75002740-75002762 CCGCGCGCCCCCGCGCCTCGGGG - Intergenic
1122065825 14:99174030-99174052 CCGCGTGTCCCCGGGGCCCAGGG - Exonic
1128497549 15:68207026-68207048 TCCCGCGTCCCCGTGGCTGGGGG + Exonic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1128764550 15:70243204-70243226 CCCCGGGTCCCCGAGGCTGGTGG + Intergenic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131493511 15:92882892-92882914 CCGCGAGGCCCGCCGGCCGGCGG + Intergenic
1132683746 16:1153833-1153855 CCTCGCGTCCCGGCGCCCCGGGG - Exonic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1135517727 16:23149352-23149374 CCGCGCCTCACCGGGCCCGGGGG + Intergenic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1138655247 16:58487708-58487730 CCGGGCGTCCCCGCCGCAGCAGG + Intronic
1139403014 16:66696870-66696892 CCGCCCCTCCCCGAGGCCCGCGG - Intergenic
1139754627 16:69132496-69132518 CCGCGCGGCGCCGCGCTCGGCGG - Exonic
1140369751 16:74407164-74407186 CTGCGCGTGCCCGCGGGAGGTGG - Intergenic
1142156338 16:88534314-88534336 TCGCCCGGCCCCGCGGCCGACGG + Exonic
1142306879 16:89290680-89290702 CCGGGCGTCCCCGCGGATGGCGG + Exonic
1145925770 17:28645379-28645401 CCGCGGGTCCCCGAGCCCCGCGG - Intronic
1145941075 17:28743775-28743797 CCGCACTTCCCCGGGGCCCGCGG + Intergenic
1148262247 17:46193564-46193586 CCGCGCCTCCTGGCGGCCCGCGG - Intronic
1148826458 17:50397615-50397637 CTGCACGTCGCCGCCGCCGGAGG + Intergenic
1149997121 17:61411254-61411276 CTGCGGGAACCCGCGGCCGGCGG + Intergenic
1150802229 17:68291409-68291431 CGGCGCGCCCCCGAGGCCGGCGG - Intronic
1150904965 17:69327284-69327306 CCGCGCGTCCCGGCGCACGCAGG + Intergenic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1151582453 17:74988027-74988049 CCGCATGGCCCCGCGGGCGGCGG - Exonic
1152363579 17:79843284-79843306 CCGCGCGGCACTGCAGCCGGGGG + Intergenic
1153457222 18:5295269-5295291 CCCCGCCCTCCCGCGGCCGGGGG + Intronic
1158601901 18:58863390-58863412 GCGCGAAGCCCCGCGGCCGGCGG - Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161317874 19:3626709-3626731 CCGCGGGTCGCCGGGGCCGAAGG - Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1162435368 19:10654767-10654789 GCACGCGGCCCCTCGGCCGGCGG + Intronic
1162657173 19:12140023-12140045 CCCTGCGTCCCCTCGGCCGCAGG - Intronic
1163118074 19:15200174-15200196 CTCCGGGTCCCCGCGGCCAGAGG + Intronic
1165309008 19:35019400-35019422 CGGCGCGGCCCCCAGGCCGGCGG + Exonic
1165331848 19:35144579-35144601 CCGCGCTTCCCAGCAGGCGGGGG + Intronic
1165443881 19:35846014-35846036 CAGCGCGTCCACGCAGCTGGCGG - Exonic
1165472032 19:36009431-36009453 CAGCGCGTCTACGCGGGCGGCGG + Exonic
1165871411 19:38975803-38975825 CCGCTGGGCCCCGCAGCCGGAGG - Exonic
1166361318 19:42254029-42254051 CCGCGCGAGCCCGGGGGCGGCGG + Intronic
1166881925 19:45935055-45935077 CCGCAGGTCCCGGTGGCCGGTGG + Exonic
1167048821 19:47066879-47066901 CCCCGCGTGCTGGCGGCCGGTGG - Exonic
1167428417 19:49441428-49441450 CCGCCCGGGCCCGCGGGCGGGGG - Exonic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
925928277 2:8685689-8685711 GCGCGGGTCCCCGTGGCTGGGGG - Intergenic
927751431 2:25673634-25673656 CAGCGCGAGCGCGCGGCCGGGGG + Exonic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
927943250 2:27118842-27118864 CCGCGCGGCGCCGCAGCAGGTGG - Exonic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
932567686 2:72919977-72919999 CCGCGGGCCGCCGCGGCCGAGGG + Intronic
933666746 2:84970955-84970977 CCCGGAGGCCCCGCGGCCGGCGG - Intergenic
934564293 2:95329948-95329970 CCTCTCGTCCCCTCTGCCGGAGG + Intronic
934763817 2:96869639-96869661 CCCCGCAGCCCCGGGGCCGGAGG - Intronic
935645321 2:105329645-105329667 CCGCGCCGCCCCGCGGCCTGGGG + Exonic
935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG + Exonic
937221581 2:120345580-120345602 CTGCCCGTCTCCGCCGCCGGCGG + Intergenic
938796098 2:134719120-134719142 CCGCTCGGCTCCGCGGCCGGTGG + Intergenic
939003987 2:136765387-136765409 CCCCGCGGCCCCGCGCCCCGCGG + Intergenic
940883186 2:158967979-158968001 CCGGGCGTCCCTGGGGCCGCGGG - Intergenic
941164865 2:162074036-162074058 ACGCGCGTCTCCGCCGCCCGCGG - Exonic
942116755 2:172735815-172735837 CCGCGGGCTCCCGCGGCCTGGGG - Intronic
946219832 2:218217106-218217128 CCGCGCGTCCAGGCGGCGAGCGG + Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946326126 2:218985460-218985482 CCGCGCGTCTCCCCGGCTGCGGG - Exonic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
946747571 2:222861215-222861237 CTGCGCGGGCCCGAGGCCGGAGG + Exonic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173750302 20:45470621-45470643 CCGGGGGTCCCCGGGTCCGGGGG - Intronic
1174054055 20:47785834-47785856 CCGCGCGTCCCCCAGGCCGGAGG - Exonic
1175367709 20:58467198-58467220 CCGGGCGTCGCCCCGGCTGGTGG - Exonic
1175429478 20:58891545-58891567 CCGCCCGTCCGCGCGCCCCGCGG + Intronic
1176311775 21:5154459-5154481 CCCCGCGTCCCCGAGGCCATGGG + Intronic
1176546836 21:8205884-8205906 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1176554741 21:8250093-8250115 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1176565787 21:8388931-8388953 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1176573662 21:8433118-8433140 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1178487451 21:33027871-33027893 CCTCGCTTCCCCGCGGCCCCTGG - Exonic
1178610180 21:34073361-34073383 CCGCCCCTAGCCGCGGCCGGCGG + Intronic
1179209426 21:39313180-39313202 CCCAGTGTCCCCGCCGCCGGGGG - Intronic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1179845275 21:44107576-44107598 CCCCGCGTCCCCGAGGCCACGGG - Intronic
1180699655 22:17774384-17774406 GCCCGCGCCCCCGCGGCTGGAGG - Intronic
1180951705 22:19723421-19723443 GCGCGCGTCCGCGCGGCCTCTGG + Exonic
1183649448 22:39145658-39145680 GCGTGCGTGCGCGCGGCCGGCGG - Intronic
1185398328 22:50603736-50603758 CCCCGCTTCCCCGCGCCCCGCGG - Intronic
1203251711 22_KI270733v1_random:122169-122191 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1203259761 22_KI270733v1_random:167251-167273 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
953909250 3:46883421-46883443 CCCGGCGTCCCGGCGGCCCGAGG - Exonic
954795902 3:53161280-53161302 CCGGGCCTCCGCGCGGCGGGCGG - Exonic
957555633 3:81761708-81761730 CCGCTCCTCCCCGCTGGCGGGGG - Exonic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
962738864 3:138348665-138348687 CCGCCGGGCCCCGCGGCCGCCGG - Intronic
967527680 3:190513895-190513917 CCGCGCCTCCTGGCGGCGGGCGG + Intergenic
968556526 4:1248750-1248772 CCGCGCGTGGCCGCGGTCGGGGG - Intronic
968651989 4:1763815-1763837 CGGCCCGGCCCCGCGGCCAGAGG - Intergenic
968879914 4:3293361-3293383 CCGCGCACCCGCCCGGCCGGAGG - Intronic
969379109 4:6782807-6782829 CCGGGCGGCGCGGCGGCCGGCGG - Exonic
970407666 4:15778842-15778864 CCGAGCGTGCCCGCGGGAGGCGG + Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
975622074 4:76306235-76306257 CCGCGCGTCACCGACGCCCGCGG + Intronic
984972559 4:185203971-185203993 CCGCGCGCCCGCGCTTCCGGAGG + Exonic
985129629 4:186726675-186726697 CAGCGAGTCGCCGCAGCCGGCGG - Intronic
985580579 5:693499-693521 CCGCGCGTCCCCGGGCCGGGTGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
988482106 5:31639451-31639473 CCGCGCGTCCCGGCTGCAGCGGG - Intronic
988577929 5:32444552-32444574 CCGCGGCTCCCCGCTGCCCGGGG + Intronic
991587470 5:68215524-68215546 CGGGGCATCCCCGCGGCTGGGGG + Intergenic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
992939611 5:81750360-81750382 GCGCGCGTCTCCGCGCCCCGCGG + Intronic
997963341 5:138338595-138338617 CCGCTGGTCCCCGGGGCGGGGGG - Intronic
999328246 5:150656679-150656701 GAGCGCCTCCCCGCGGTCGGCGG + Intronic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1000318896 5:160118700-160118722 CCTCGCTTCCCCGCTGCCCGGGG - Intronic
1002190146 5:177473638-177473660 CCGAGCGAGCCAGCGGCCGGGGG + Intronic
1003603971 6:7542639-7542661 CTGCGCGTCCCGGCGGCGCGGGG + Intronic
1003871173 6:10404463-10404485 CCGCCCCGCCCCGCGGCCGGGGG - Intronic
1004043916 6:12009067-12009089 CGGCGTGACCCGGCGGCCGGCGG + Intronic
1004228944 6:13814068-13814090 CCGGGCGTCGCCGCTGCCGCCGG - Exonic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1006136101 6:31897299-31897321 CCCGGGGTCCCCGCGGCCTGGGG - Intronic
1006458332 6:34144406-34144428 CTGCGCGTCTACGCGGCCGCCGG - Intronic
1006706759 6:36027520-36027542 GCGCGCCTCACCGTGGCCGGCGG - Intergenic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1007623513 6:43229224-43229246 GCCCGCGTCCCCGCGTCCCGCGG + Intronic
1007644465 6:43369536-43369558 GAGCGCGCCCCCGCGGCTGGCGG + Intergenic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1011765011 6:90611055-90611077 CCGCGCGTCCTCTCCCCCGGCGG - Intergenic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1017073955 6:150600510-150600532 CCGCGCGTCCCCGGGTCCTCGGG - Intronic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1019395732 7:816746-816768 CCCCGCGTCCCCCCGGCCCCCGG - Intronic
1019900135 7:4013969-4013991 CCCCGTGTCCCCGCCGCCTGCGG + Intronic
1020283733 7:6664380-6664402 CCGCGGGACGCAGCGGCCGGAGG - Intergenic
1026807099 7:73435470-73435492 CCGCGGGGCCCGGAGGCCGGAGG + Exonic
1029112200 7:98218097-98218119 CCGTGCGGCCCGGCAGCCGGTGG + Intronic
1031966526 7:128031571-128031593 CCCCGCGTGCCGGCAGCCGGCGG - Intronic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1032037290 7:128530636-128530658 CCGCGCGTCGCCCCGGAGGGCGG - Intergenic
1032298758 7:130668288-130668310 GCGCGCGTCTCCGCGTCCAGGGG - Intronic
1033390727 7:140924838-140924860 CCGGGCGGCGCCGCGGGCGGAGG + Intergenic
1034197944 7:149262365-149262387 CCGGGCGTCCGCGGGGCCGAGGG - Intronic
1034469847 7:151249214-151249236 TCGCGCCTGCCCGGGGCCGGCGG + Intronic
1036788938 8:11704991-11705013 CCGGGCAGCCCCGTGGCCGGCGG - Intronic
1037589857 8:20303626-20303648 CCGTGCGTCCGCGCGTCCGTCGG - Intronic
1037857589 8:22382996-22383018 GCGTGAGTCACCGCGGCCGGTGG + Intronic
1040471555 8:47738638-47738660 ACGCGCGTGCCCACGGTCGGGGG - Exonic
1041464541 8:58145713-58145735 CCGCGCGTCGGCGCAGGCGGGGG + Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042307021 8:67343321-67343343 CCGCGGCTCCCAGCGGCTGGAGG + Exonic
1044569344 8:93700346-93700368 CCGCGCGTCCCTGCCGGCGAAGG - Intronic
1045510075 8:102806897-102806919 CCGCGCGGCCCGGGGGGCGGGGG + Intergenic
1048554029 8:135457765-135457787 CCCCGGGTCCCCGCCGCTGGGGG + Exonic
1049090661 8:140511464-140511486 GCGCGGGTGCCCGCAGCCGGCGG - Exonic
1049850289 8:144827050-144827072 CCCCGCGTCCCTGCGACAGGAGG - Intergenic
1053034093 9:34809922-34809944 CCCCGCGCCCCCGCGCCCCGAGG - Intergenic
1053050564 9:34958080-34958102 CCTCGCGGCTCCGCGGGCGGCGG - Intronic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1055757776 9:79573241-79573263 CCGCTCGCCCCGGCGGCCCGCGG - Intronic
1057054500 9:91950194-91950216 GCGCTCGTCCTGGCGGCCGGCGG - Intergenic
1057054534 9:91950300-91950322 CCGCGCGTTCCCCCGGCAGGGGG - Intergenic
1060811327 9:126612919-126612941 CCGCGCGTCCCAGCGACCCCTGG + Intergenic
1061108792 9:128552528-128552550 ACGCGCGCTCCCGCGGCGGGCGG - Intergenic
1061348096 9:130042887-130042909 CTGCGTTTCCCCGCGGCCTGGGG - Intronic
1061453426 9:130681228-130681250 CCGCCCCGCCCCGCGGCCAGAGG + Exonic
1061559708 9:131394429-131394451 CCCCGCAGCCCCGCGCCCGGCGG - Intronic
1061737262 9:132670122-132670144 CCGCGCGTGCCCCCGCCTGGTGG + Exonic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062349593 9:136132532-136132554 CCCCGCGTCCCTGCAGCCAGGGG + Intergenic
1203442451 Un_GL000219v1:22390-22412 CCGTGCGTCCCCGTGGCCTGTGG + Intergenic
1203468113 Un_GL000220v1:105320-105342 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1203475934 Un_GL000220v1:149292-149314 TCGCGCGTCGCCTGGGCCGGCGG + Intergenic
1203513259 Un_KI270741v1:141299-141321 CCGTGCGTCCCCGTGGCCTGTGG + Intergenic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic