ID: 1014235037

View in Genome Browser
Species Human (GRCh38)
Location 6:118944370-118944392
Sequence CTGTGAAAGTAGTACTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014235035_1014235037 -6 Left 1014235035 6:118944353-118944375 CCAAAACTTATGGAATGCTGTGA No data
Right 1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014235037 Original CRISPR CTGTGAAAGTAGTACTAAGA GGG Intergenic
No off target data available for this crispr