ID: 1014235073

View in Genome Browser
Species Human (GRCh38)
Location 6:118944958-118944980
Sequence GCTCCAAGGAAGCCCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014235067_1014235073 26 Left 1014235067 6:118944909-118944931 CCTGCTGGGTGGCTAGACCTAGA 0: 2
1: 42
2: 129
3: 163
4: 287
Right 1014235073 6:118944958-118944980 GCTCCAAGGAAGCCCCATCCAGG No data
1014235066_1014235073 27 Left 1014235066 6:118944908-118944930 CCCTGCTGGGTGGCTAGACCTAG No data
Right 1014235073 6:118944958-118944980 GCTCCAAGGAAGCCCCATCCAGG No data
1014235070_1014235073 9 Left 1014235070 6:118944926-118944948 CCTAGAAGGGCAATAACAATCAC No data
Right 1014235073 6:118944958-118944980 GCTCCAAGGAAGCCCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014235073 Original CRISPR GCTCCAAGGAAGCCCCATCC AGG Intergenic
No off target data available for this crispr