ID: 1014236408

View in Genome Browser
Species Human (GRCh38)
Location 6:118960864-118960886
Sequence CTGAACATACCCATGCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014236404_1014236408 24 Left 1014236404 6:118960817-118960839 CCAGTAGTCATGTTCCTTGAGCT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG 0: 1
1: 0
2: 0
3: 16
4: 173
1014236405_1014236408 10 Left 1014236405 6:118960831-118960853 CCTTGAGCTCATGCACATGCATC 0: 1
1: 1
2: 1
3: 13
4: 153
Right 1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG 0: 1
1: 0
2: 0
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014236408 Original CRISPR CTGAACATACCCATGCACAA GGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906841340 1:49142849-49142871 CTCAAAATACCCTTGTACAATGG + Intronic
907537147 1:55174036-55174058 TTAAACATAACCATGCACTATGG + Intronic
908777737 1:67657465-67657487 ATGAACATACACGTGCACACAGG + Intergenic
909168865 1:72267611-72267633 TTTAACATGCCTATGCACAATGG - Intronic
910954151 1:92683251-92683273 CTGATGATACCCATGCAAACAGG + Intronic
914453946 1:147817895-147817917 CTGAATTTATCCATGCCCAAGGG - Intergenic
916241320 1:162642716-162642738 CTGAACACACCCATGAGGAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918177095 1:182056428-182056450 CAGCACATACGAATGCACAACGG - Exonic
919015995 1:192037362-192037384 CCAAACTTACTCATGCACAATGG - Intergenic
921507754 1:215993470-215993492 CTGAAGTTAGCCTTGCACAAAGG + Intronic
1066479735 10:35784199-35784221 CTGAACATAGCCAAGCAAGAAGG + Intergenic
1066646221 10:37612562-37612584 CTGATCTTACCCTTGCACATTGG - Intergenic
1067062243 10:43083464-43083486 GTGCACATAGCCAGGCACAAGGG - Intronic
1067258523 10:44666259-44666281 CTGCACATAGCCAGGCACACTGG + Intergenic
1068822674 10:61395804-61395826 CTGCACATTCACATGCACAAGGG - Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071373563 10:84978939-84978961 ATGACCCTACCCATGCACCAGGG + Intergenic
1072202428 10:93172654-93172676 CTGAACAGACTAATGCACTAGGG + Intergenic
1080062003 11:27966695-27966717 CTGTACATATCTGTGCACAAAGG + Intergenic
1080697668 11:34617139-34617161 CTAAACTTACCCAAGCACCAAGG - Intergenic
1085863348 11:80259059-80259081 CTGAAAATAGCCAAACACAAGGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087971154 11:104486087-104486109 CTACACATACACATGCACACTGG + Intergenic
1088342318 11:108782455-108782477 CTGAACAGAAGCATGCAGAAAGG - Intronic
1090403151 11:126461595-126461617 CTCAAGATACCCACACACAAAGG - Intronic
1092048928 12:5454296-5454318 CTGAACACAGACATGCACAGAGG - Intronic
1092509264 12:9136508-9136530 ATGCACACACACATGCACAATGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1101126372 12:101639349-101639371 CTTAACATAGCCATGCAGACAGG + Intronic
1101215504 12:102577819-102577841 GCGCACATACCCATGCACAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102173465 12:110859715-110859737 GTGATCCTACCCATCCACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106373062 13:29155995-29156017 TTGCCCATACCCATGCACACTGG + Intronic
1106650945 13:31689084-31689106 CTGATGATACCCAGGCAAAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1108161855 13:47648809-47648831 CGGACCATACCCATGCTCCATGG - Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109439015 13:62344231-62344253 CTGCACATAGCCAGGCACACTGG - Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1112617563 13:101020825-101020847 CTGAACACACCCATGGCCAGTGG - Intergenic
1112669533 13:101618648-101618670 GTGTACATACGCATGCACATGGG + Intronic
1112881012 13:104106649-104106671 CAAAACATTCCCAAGCACAAAGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113839054 13:113348171-113348193 CAGAACATAGCCAGGCACAGTGG + Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1122103226 14:99430233-99430255 ATGCACACACACATGCACAATGG + Intronic
1124173103 15:27395081-27395103 TTGTACAAACACATGCACAATGG - Intronic
1124406952 15:29401619-29401641 CTGTACATACCCATACTCAATGG + Intronic
1125909142 15:43420811-43420833 CTGAGGAGACCCATGGACAAAGG - Intronic
1126072479 15:44876960-44876982 CTGAACATACTCACGCAGGATGG + Intergenic
1126085710 15:45009692-45009714 CTGAGCATACTCATGCAGGATGG - Intergenic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1129225831 15:74169880-74169902 ATGAACACACGCATGCACACGGG + Intergenic
1129591198 15:76916487-76916509 CTGAACACAGCCAGGCACAATGG - Intergenic
1133882865 16:9799290-9799312 CTGAACACAGACATGCACACAGG + Intronic
1134559515 16:15196164-15196186 CTGAAGGAGCCCATGCACAAAGG + Intergenic
1134840606 16:17398787-17398809 TTGGACATAGCCATGCACACAGG - Intronic
1134920054 16:18107775-18107797 CTGAAGGAGCCCATGCACAAAGG + Intergenic
1137007210 16:35288044-35288066 CTGCACATACCCAGGCAAACAGG + Intergenic
1137628603 16:49925668-49925690 CTGTACATCCACATGCAAAAAGG + Intergenic
1138266895 16:55666000-55666022 CTGTGCATACTCATGCAAAATGG - Intronic
1139269619 16:65670189-65670211 GGGAACAAACCCATGCACAAAGG + Intergenic
1141350126 16:83287057-83287079 CTGAAGGTACCCATGTAAAAAGG + Intronic
1141729592 16:85812735-85812757 CTGTGCAGACCCATCCACAAAGG + Intergenic
1142789621 17:2253894-2253916 CAGAACACACCCAAGCCCAACGG + Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145828082 17:27892527-27892549 GTGAACAAACCCAGTCACAAGGG + Intronic
1146528041 17:33583732-33583754 CCGAACATACCAATGTTCAAGGG + Intronic
1149723492 17:58868757-58868779 CTGAACGTACCCATACCCTATGG - Intronic
1154029688 18:10742332-10742354 ATGAATATATCCATTCACAATGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158562052 18:58522701-58522723 CTGAAAAATCCCATGCAGAAGGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158950525 18:62490700-62490722 CTGAACAGGTCCATGCACCAAGG - Intergenic
1160207367 18:76845966-76845988 CTGCAGAGACCCCTGCACAATGG + Intronic
1165101299 19:33440172-33440194 CTCAACTTCCCCAGGCACAAGGG + Intronic
1166344788 19:42158585-42158607 CAGAACAGGCCCTTGCACAAAGG + Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925699704 2:6623557-6623579 CTGAACAGACTCATACAAAATGG + Intergenic
925920317 2:8633567-8633589 CTGAGCATTCCCACGCACCAGGG + Intergenic
926419633 2:12684113-12684135 ATTAAAATACCCATGCACACTGG + Intergenic
929678005 2:43957085-43957107 CTGAACATACATATGCAAATTGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933825935 2:86161047-86161069 CTGATCATGCCCCTGCACTACGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936339962 2:111622480-111622502 GAGAACAGAGCCATGCACAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
941902941 2:170695057-170695079 CAGAACAGTCTCATGCACAAAGG + Intergenic
947206497 2:227666102-227666124 CAGAACATTTCCTTGCACAATGG - Intergenic
948025945 2:234776314-234776336 CTGATAATACCCAGGCACACAGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1172462875 20:35133335-35133357 CTTAACATTTCCATGCACACTGG - Intronic
1175914918 20:62421645-62421667 CAGCACATACACATGCACACTGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179676205 21:42984226-42984248 ATGAACATAGCCAGGCACAGGGG - Intronic
1182659568 22:31915697-31915719 CTGAACACACCCAAGCTCCACGG + Intergenic
951268919 3:20602176-20602198 CTGAACATTCCCATTGGCAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
958048299 3:88313374-88313396 CTGAACCCACCCTTCCACAATGG + Intergenic
960162773 3:114368449-114368471 GTGAACATCCCAATGCAGAATGG - Intronic
962637325 3:137344629-137344651 CTTACCATACCCTTGCAGAATGG - Intergenic
964933503 3:162053297-162053319 CTGAACAGAACCATGATCAATGG - Intergenic
965696135 3:171410374-171410396 CTGAAGATACTCATCCAGAAAGG - Intronic
970759304 4:19465057-19465079 GAGAACATACCCATGAACAATGG + Intergenic
970913088 4:21301550-21301572 CTGAACTTAGACATGCAAAATGG + Intronic
972324530 4:38002816-38002838 CTGAACATACCAAACCAAAATGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
978263209 4:106788945-106788967 CTGAGCATACCCACCCACAGAGG - Intergenic
978686661 4:111453298-111453320 CAGAACATACCCATTCTCTATGG + Intergenic
979768891 4:124497758-124497780 CTGAACATTCCCAAGAATAAAGG - Intergenic
982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG + Intergenic
982606912 4:157527241-157527263 ATGCAATTACCCATGCACAAAGG + Intergenic
982712448 4:158770267-158770289 CTCAACATACCTGTGCTCAAAGG - Intronic
984231371 4:177104251-177104273 CTGAAAATAGCCACGCACAGTGG + Intergenic
990288175 5:54321611-54321633 CAGAACATACACACACACAAAGG - Intergenic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
992138909 5:73775954-73775976 CTGAACACACTCACACACAAAGG - Intronic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992554185 5:77887135-77887157 CTGAACATAACCATCCACTATGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999373001 5:151067681-151067703 CTGAAGATACCCTGGCACACAGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000820840 5:165981579-165981601 TTGAACACAGCCATGAACAAAGG - Intergenic
1001288508 5:170440293-170440315 CTGAGCAAACCAATACACAAGGG + Intronic
1003378780 6:5603670-5603692 CTGAACACAGGCATGCACACAGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005013437 6:21357090-21357112 ATGATCATCCCCTTGCACAAAGG + Intergenic
1008445216 6:51581459-51581481 CTAAACTCACCCATGCACACAGG + Intergenic
1008783710 6:55140047-55140069 ATGAACACACCCATGCATAGTGG + Intronic
1009753211 6:67899715-67899737 CTGTACAGACTCATGAACAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012316553 6:97788011-97788033 CTGCACATCCGCATGCAAAAAGG - Intergenic
1013570596 6:111420594-111420616 CTGAACAAGCCCATGTACACAGG + Intronic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1016205566 6:141464297-141464319 CTGAAAAGATTCATGCACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020390557 7:7653561-7653583 GTGATCATACCCATTCACAGAGG + Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021993242 7:26156151-26156173 GTGTGCATTCCCATGCACAATGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030125451 7:106148747-106148769 CAAAACAGACCCATGCACACAGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1033509137 7:142036965-142036987 GTGAACTTACTCATGCAAAAGGG - Exonic
1034040911 7:147875603-147875625 CTTAACATGACCAGGCACAATGG + Intronic
1034409056 7:150928626-150928648 CGGAACATAACCATGCAAGAAGG + Intergenic
1039104240 8:33973099-33973121 CACCACATTCCCATGCACAAGGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042478166 8:69273366-69273388 CTGAACTTACCTATGAAAAATGG + Intergenic
1043131846 8:76472390-76472412 CAGAACAAACCCGTGCACAGAGG - Intergenic
1043798541 8:84578150-84578172 CTGCACACAGCCATGCACACTGG + Intronic
1046668356 8:117030844-117030866 TTGAACATACCCCTGAATAAAGG - Intronic
1046972449 8:120237915-120237937 CTGATGATACCCAGGCACACAGG - Intronic
1046975086 8:120265984-120266006 CTAAACATAGCCATTCACAGAGG - Intronic
1051409357 9:16773196-16773218 CTGTACACACACATGCACTATGG + Intronic
1051828538 9:21249668-21249690 CTGAACATACCAATGATCCAAGG + Intergenic
1052666426 9:31500487-31500509 CTGTACACACACATACACAATGG + Intergenic
1054778490 9:69144432-69144454 CTAAACAAACCCATACATAAAGG - Intronic
1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059446461 9:114341324-114341346 CTCAACAAACCCATGTACCAAGG - Intronic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060217468 9:121746904-121746926 GTGAACACACCCATGCATCATGG - Intronic
1062195937 9:135274127-135274149 ATGTACACACCCATGAACAAAGG + Intergenic
1188745608 X:33838951-33838973 CTGTATATAGCCATGCCCAAGGG + Intergenic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1191117505 X:56866960-56866982 GTGATCATCCCCTTGCACAAGGG - Intergenic
1192875168 X:75222434-75222456 CTGAACATACCCAGGGCCCAGGG - Intergenic
1197623908 X:128781593-128781615 CTGAACATACCCATTGGCAGTGG + Intergenic
1199066697 X:143427037-143427059 ATAAACATACCCATGAATAAAGG - Intergenic
1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG + Intronic
1201286453 Y:12383018-12383040 CTGCACACACACATGCACACTGG - Intergenic
1201499219 Y:14624021-14624043 CTCATCACACACATGCACAAAGG - Intronic