ID: 1014236873

View in Genome Browser
Species Human (GRCh38)
Location 6:118967930-118967952
Sequence ACCTCTCTAGGGTTTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014236873 Original CRISPR ACCTCTCTAGGGTTTTGGGT GGG (reversed) Intronic
900267476 1:1765614-1765636 ACTACTCTAGGTTTTTGGCTGGG + Intronic
901330927 1:8407885-8407907 ACCTCTCTAGGGTTTCTGCCAGG - Intronic
902786153 1:18733943-18733965 ATCTCTGTGGGCTTTTGGGTTGG + Intronic
903133021 1:21291238-21291260 ACCTCTCTGGGGTTCTTGGTTGG - Intronic
904695512 1:32328652-32328674 CCCTCTCTAGGGTGTTGTGGAGG - Intronic
910922819 1:92367717-92367739 GCTTCTCTATGGTTTGGGGTTGG - Intronic
911108671 1:94160484-94160506 ACCTCTCTAGAGTGCTGGGGGGG - Intronic
913670096 1:121089246-121089268 GCAGATCTAGGGTTTTGGGTGGG - Intronic
913673631 1:121121561-121121583 CCCTCTCTAGGGGTCTGGATCGG - Intergenic
913787592 1:122474907-122474929 ACCTCTCTGAGGATTTCGGTTGG + Intergenic
914021861 1:143876643-143876665 GCAGATCTAGGGTTTTGGGTGGG - Intergenic
914025409 1:143908914-143908936 CCCTCTCTAGGGGTCTGGATCGG - Intergenic
914663843 1:149816633-149816655 CCCTCTCTAGGGGTCTGGATCGG - Intergenic
916575132 1:166060212-166060234 CCCTCCCTATGCTTTTGGGTGGG - Intronic
918507100 1:185267893-185267915 ACCTCTCAAGAATTTTGTGTGGG + Intronic
920201885 1:204264702-204264724 TCCTCTCTTGGGGGTTGGGTGGG - Intronic
920660212 1:207909059-207909081 AGCTTTCTAGGGTTTTTGCTTGG - Intronic
920981790 1:210843497-210843519 TTATCACTAGGGTTTTGGGTTGG + Intronic
923376071 1:233364146-233364168 ACCTCTCTGGGGTTGGGTGTTGG + Intronic
924242278 1:242052849-242052871 AACTCTCTAGGGCATTGGTTTGG + Intergenic
924522314 1:244815908-244815930 CCCTCTCTTGGGGTCTGGGTCGG + Intergenic
1064153740 10:12886748-12886770 ATCTCTCCAGTGTGTTGGGTTGG - Intergenic
1066108864 10:32179006-32179028 ACCTCTCTTGGGGTATGGATCGG - Intergenic
1068922886 10:62503542-62503564 ACCTCTCTGGTCTATTGGGTTGG + Intronic
1069899120 10:71696861-71696883 AGCTCTCTAGGCTCTTTGGTGGG + Intronic
1070141404 10:73740909-73740931 ACCCCTCTAGGTTTCTGGCTGGG + Intergenic
1070939303 10:80329240-80329262 ACCTCTTTAGGGTTGTGAGAAGG - Intergenic
1071610451 10:87027075-87027097 ACCCCTCTAGGCTTCTGGCTGGG - Intergenic
1071782344 10:88860273-88860295 TCCTCTCTAGGCTTTTGTGTTGG - Intergenic
1071882844 10:89918232-89918254 CCCTCTCTCTGGTTTTGGCTAGG - Intergenic
1073133103 10:101203374-101203396 CCCTCTCTTGGGGTCTGGGTAGG + Intergenic
1073782751 10:106857287-106857309 CCGTCTGTGGGGTTTTGGGTAGG - Intronic
1075072610 10:119328676-119328698 ACCTTTCTGGGGTGTTGAGTTGG + Intronic
1077286766 11:1769976-1769998 ATCCTTCTAGGGTTTTGGGTAGG - Intergenic
1078376902 11:10802937-10802959 ACCCCTCAAGCGTTTGGGGTGGG + Intronic
1079500729 11:21098554-21098576 ACTACTCTACTGTTTTGGGTGGG - Intronic
1080845959 11:36027036-36027058 CCCTCTCTTGGAGTTTGGGTCGG + Intronic
1081492250 11:43577908-43577930 AGCTCTCTGGGGTTGTGGGCTGG + Intronic
1082512275 11:53841898-53841920 ACCTCTCTGAGGATTTCGGTTGG + Intergenic
1083045616 11:59732331-59732353 CCCTCTCTTGGGTTCTGGGTCGG - Intronic
1085963768 11:81496145-81496167 CCCTCTCTAGGGGTCTGGATTGG + Intergenic
1086594399 11:88553861-88553883 ACCTCACAGGAGTTTTGGGTAGG + Intronic
1087645638 11:100805476-100805498 CCCTCTCTTGGGATTTGGATCGG - Intronic
1091364616 11:135007290-135007312 ACCTCTCTAGGGTAAAGTGTGGG + Intergenic
1094165095 12:27435395-27435417 ACCTCTTTAGAGTTTAGAGTAGG - Intergenic
1094815260 12:34177054-34177076 AACTCTCTAGGGCATTGGTTTGG - Intergenic
1094894793 12:35016130-35016152 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094910260 12:35266133-35266155 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094911478 12:35285841-35285863 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094921660 12:35450914-35450936 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094949807 12:35907240-35907262 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094975346 12:36319300-36319322 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094981115 12:36412718-36412740 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1094992723 12:36600936-36600958 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1095019197 12:37029454-37029476 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1095024422 12:37114029-37114051 ACCTCTTTAGGGCCTTCGGTTGG + Intergenic
1096509682 12:52120765-52120787 CCCTCTCTTGGGTTCTGGATTGG - Intergenic
1100426539 12:94492727-94492749 CCCTCTCTTGGGGTCTGGGTTGG - Intergenic
1101210963 12:102534803-102534825 AACTCTCTAGGGGATGGGGTGGG + Intergenic
1101326311 12:103718813-103718835 ATGACTCTAGGGTTTTCGGTTGG + Intronic
1102813491 12:115843853-115843875 TCCTCCCTAGGGTTTTTGGTGGG + Intergenic
1102937582 12:116910913-116910935 GCCGCTCTAGGGTTCCGGGTGGG - Intergenic
1104510677 12:129374904-129374926 ACCTCTCATGGCTTGTGGGTGGG - Intronic
1104616784 12:130277050-130277072 GCCCCTCCAGTGTTTTGGGTGGG - Intergenic
1104800380 12:131551385-131551407 CCCTCTCTTGGGGTCTGGGTCGG - Intergenic
1105800866 13:23902481-23902503 ATGTCTATAGAGTTTTGGGTAGG - Intronic
1106875806 13:34071429-34071451 ACCTTTCTAGGTTTCTGGCTGGG + Intergenic
1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG + Intronic
1110084759 13:71364286-71364308 ACATTTCTAGGGTCTTGGGATGG + Intergenic
1116188439 14:41631070-41631092 ACCTCTAGAGGTTTTTGAGTGGG - Intronic
1117819008 14:59629340-59629362 GCCTCTGTAGGGTTTTGCTTCGG - Intronic
1119783572 14:77295943-77295965 ACCTCTCCATGGTGCTGGGTGGG - Intronic
1120538895 14:85731565-85731587 ATCTCTCTCTGGTTTTGGCTAGG + Intergenic
1121805785 14:96820967-96820989 AACTCTCTAGGGTTCATGGTAGG - Intronic
1122570327 14:102694178-102694200 ACTTCTCTGGGGATTGGGGTTGG + Intronic
1128412051 15:67409419-67409441 ACCTCTCTAGTGTTTGTGGTCGG + Intronic
1130434220 15:83881271-83881293 AACTTTCTAGGGTCCTGGGTTGG + Intronic
1132904764 16:2276926-2276948 ACCTCTCTGGGGCTCTGGGGTGG - Intronic
1134328724 16:13230620-13230642 ACCTCTCTTGGGGTCTAGGTCGG - Intronic
1135227622 16:20675104-20675126 ACCTCTCTGGTGTCCTGGGTAGG - Intronic
1135633222 16:24052352-24052374 ACCTCTCTTGGGTTCTGGATCGG - Intronic
1136639374 16:31549841-31549863 ACCTCTCTTGGGGTCTGGATCGG + Intergenic
1140995093 16:80251382-80251404 ACCTCTCTTGGGGTCTGGATAGG + Intergenic
1141106066 16:81234808-81234830 ACCAGTCTTGGGTCTTGGGTTGG - Intergenic
1141656990 16:85421768-85421790 ACCTCTCTGGGGTTCCTGGTGGG - Intergenic
1147190239 17:38734154-38734176 ACCTCTCAAGGGGTGGGGGTGGG + Exonic
1147845438 17:43401144-43401166 ATCTCTGTAGTTTTTTGGGTGGG + Intergenic
1149073790 17:52574823-52574845 ACCATTGTAGGGTCTTGGGTGGG + Intergenic
1150196808 17:63307184-63307206 ACCACTGGAGGGTTTTGCGTAGG + Intronic
1152635803 17:81430058-81430080 GCCTCTCTGGGGCTTGGGGTGGG + Intronic
1156816823 18:41321437-41321459 AGCTTTCTATGGTTTTGGGTGGG - Intergenic
1157100709 18:44726424-44726446 ACCTCTTAAGAGTTTTGGGGAGG - Intronic
1160141340 18:76326340-76326362 ACTTCTCCAGGTTTTTGGGAGGG - Intergenic
1160236712 18:77091614-77091636 ACCTGTATAGGGGTGTGGGTGGG - Intronic
1162010077 19:7807822-7807844 TTCTTTCTTGGGTTTTGGGTTGG - Intergenic
1162208553 19:9074102-9074124 CCCTCTCTTGGGGTTTGGATTGG - Intergenic
1162209892 19:9082979-9083001 CCCTCTCTTGGGATTTGGATTGG + Intergenic
1164027315 19:21364568-21364590 CCCTCTCTTGGGGTTTGGATTGG - Intronic
1164070431 19:21763230-21763252 CCCTCTCTTGGGGTTTGGATTGG + Intronic
1165035946 19:33033923-33033945 AGCTCTCTAGGGATTTTGGTGGG - Intronic
925773598 2:7309205-7309227 ATCTCTCTAGGTTTTTGAGCTGG - Intergenic
926245887 2:11122150-11122172 CCCTCTCTTGGGTTGTGGATCGG - Intergenic
928410220 2:31048806-31048828 ACTTCTCTGGGGTTTGGGATAGG - Intronic
928439779 2:31282732-31282754 CCCTCTCTTGGGTTCTGGATGGG + Intergenic
932416165 2:71575052-71575074 ACCTCCCTAGGGGTTTGGGCTGG + Intronic
932718659 2:74122331-74122353 ACCTCTCTGGGATTTTGGATTGG - Intergenic
932860836 2:75289616-75289638 CCCTCTCTAGGGGTCTGGATGGG + Intergenic
933287736 2:80402386-80402408 ACCTCTCTGGAGGTTGGGGTGGG + Intronic
939012829 2:136866702-136866724 AAATCTCTAAGGTTTTAGGTAGG - Intronic
941631835 2:167892623-167892645 GCCTCTAAAGGGTTTTGAGTAGG + Intergenic
943249408 2:185497843-185497865 ACCTCTTTAGGGTTGGGGATAGG + Intergenic
944563510 2:200964391-200964413 ACATCTCCAGGGTTTGGGGTAGG + Intergenic
945063975 2:205932728-205932750 CCCTCTCTTGGGGTTTGGATTGG + Intergenic
945364616 2:208936394-208936416 ACCTCTCTAGTAATTTGAGTAGG - Intergenic
945549887 2:211208499-211208521 AACACTATAGGGTTTTTGGTAGG - Intergenic
945786110 2:214239755-214239777 TCCTCTCCAGGATTCTGGGTGGG - Intronic
946110247 2:217408657-217408679 ACCTCTCTTGGGGTATGGATTGG - Intronic
948019930 2:234723704-234723726 CCCTCTCTTGGGGTTTGGCTTGG - Intergenic
948060192 2:235037350-235037372 ACCTCCCTAGGGTTCTGGAAAGG + Intronic
948133262 2:235617010-235617032 AGCTCTCTAGGGATTGGGCTGGG + Intronic
1169228035 20:3868226-3868248 ACCTAACTGGGGTTTAGGGTAGG - Exonic
1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG + Intergenic
1172060858 20:32186436-32186458 ACCAGTGTAGGGTTTTGGATGGG + Intergenic
1172798763 20:37561770-37561792 CCCTCTCTTGGGGTTTGGATCGG + Intergenic
1175444638 20:59011541-59011563 CCCTCTCTTGGGATCTGGGTTGG - Intergenic
1176041100 20:63066281-63066303 GCTTCTCTAGGGTTTGGGATGGG + Intergenic
1182825175 22:33258778-33258800 ACCTCTCTTGGGGTCTGGATCGG + Intronic
1184289409 22:43490372-43490394 ACCTCTCTGGGCATTGGGGTGGG + Intronic
952338772 3:32427873-32427895 ACCTCTGTAGTGTTTAGGATAGG + Intronic
956713556 3:72058918-72058940 ACCTCTCTAGAGTTTTCCCTGGG + Intergenic
956782541 3:72615518-72615540 ACCTCTATAGGGTTGTTGGGAGG + Intergenic
958096539 3:88952856-88952878 ACTGCTCTAGGGTGTTGGCTAGG - Intergenic
958890430 3:99776598-99776620 ACCTCTCTTGGGGTCTGGATTGG - Intronic
959190243 3:103102654-103102676 ACCTATCTATGGTGTTGGTTGGG + Intergenic
960609038 3:119538090-119538112 ACCTCTCTAGGGTTTCTGTGAGG - Intronic
961156042 3:124680639-124680661 ATCTCTCTTGGGTTTTGTGGTGG - Intronic
961839244 3:129694906-129694928 CCCTCTCTTGGGGTTTGGATTGG + Intronic
962338317 3:134558823-134558845 ACCTAACTAGGGGATTGGGTGGG - Intronic
963315478 3:143754050-143754072 CCATCTCTAGAGTTTTGGATCGG + Intronic
963368636 3:144369330-144369352 AGCACTCTAGGGGGTTGGGTGGG - Intergenic
963983120 3:151562487-151562509 CCCTCTCTTGGGTTCTGGATTGG + Intergenic
966750290 3:183315578-183315600 ACTTCTCTCAGGTTATGGGTTGG - Intronic
968241483 3:197091854-197091876 ACTTCTCTGGGATTTTGTGTAGG + Intronic
968872049 4:3247153-3247175 ACCTCCCCAGGGTTCTGGGAGGG + Intronic
969614389 4:8243919-8243941 CCCTCTCTTGGGGTCTGGGTCGG + Intergenic
970940624 4:21629036-21629058 ACCCCTCCAAGGTGTTGGGTGGG + Intronic
971452305 4:26811532-26811554 CCCTCTCTAGGGGTCTGGATCGG - Intergenic
974333610 4:60510699-60510721 AGTTCTCTAGGATTTTGTGTAGG - Intergenic
979773892 4:124563275-124563297 CCCTCTCTTGGGGTTTGGATTGG + Intergenic
980528511 4:134020104-134020126 TCCTCTCTTGGGGTCTGGGTAGG - Intergenic
983178943 4:164624105-164624127 ATCTCTGTAGGATTTTGGGGAGG - Intergenic
983528946 4:168790065-168790087 GCCTCTCTCCGGTTTTGTGTAGG + Intronic
988118571 5:26928909-26928931 ACCTCTCCAGGATATTGGTTTGG + Intronic
988184186 5:27838264-27838286 TCTCTTCTAGGGTTTTGGGTTGG - Intergenic
988809959 5:34775180-34775202 AACTCTGTAGGGCGTTGGGTTGG + Intronic
990544174 5:56805746-56805768 ACCTCTCTTGCCCTTTGGGTAGG - Intergenic
991503216 5:67298180-67298202 ATTTCTCTTGTGTTTTGGGTGGG - Intergenic
992609677 5:78496487-78496509 ATCCCTCTAGTGTTTTGTGTTGG + Intronic
995050140 5:107693891-107693913 AACTCTCTAGGGCTTTGGTCTGG + Intergenic
998358956 5:141567449-141567471 GCTTCTCTTGGGTTTTGAGTAGG - Intronic
1002446917 5:179295575-179295597 CCATCTCTAGGGTTTGGGATGGG + Intronic
1007433743 6:41793003-41793025 ACCTCTCTAGGGCTTATGCTGGG + Exonic
1008830621 6:55756390-55756412 ACCTTTTTAGGCTTTTGGGGAGG - Intronic
1011641992 6:89424386-89424408 ACCTCAGTAGGGTTGTGGGAAGG + Intergenic
1012290347 6:97447933-97447955 GCCTCTGTAAGGTTTTGAGTTGG - Intergenic
1014236873 6:118967930-118967952 ACCTCTCTAGGGTTTTGGGTGGG - Intronic
1019660915 7:2223573-2223595 AGCTCTCCTGGGTTTTGGGCTGG - Intronic
1022541288 7:31137547-31137569 ACCTGGCTGGGCTTTTGGGTAGG - Intergenic
1023588276 7:41753771-41753793 CCCTCTCTTGGGGTTTGGATTGG - Intergenic
1028322551 7:89478193-89478215 TCCCCTGTATGGTTTTGGGTTGG + Intergenic
1028650844 7:93149450-93149472 CCCTCTCTAGGGGTCTGGATTGG + Intergenic
1029162215 7:98560457-98560479 ACACCTATAGCGTTTTGGGTGGG + Intergenic
1030610133 7:111680197-111680219 ACCTTTCTAGGGTTTATGGCTGG + Intergenic
1032016096 7:128381187-128381209 CCCTCTCCTGGGTATTGGGTGGG + Intergenic
1033162464 7:139009783-139009805 CCCTCTCTTGGGTTCTGGATTGG - Intergenic
1033438967 7:141361267-141361289 ATCCCTCTAGGCTTTAGGGTGGG + Intronic
1034250225 7:149684414-149684436 ACCTCTCTGGGGGTGGGGGTGGG + Intergenic
1034323648 7:150208951-150208973 TCCTCTCTAGGATTTTGATTTGG - Intergenic
1034326331 7:150237385-150237407 AGTTCTCTAGGGCTGTGGGTGGG - Intergenic
1034766880 7:153731871-153731893 AGTTCTCTAGGGCTGTGGGTGGG + Intergenic
1037523589 8:19703291-19703313 ACCTCTCTTGGTTTGTTGGTTGG + Intronic
1037842425 8:22254810-22254832 ACCTCTCTTGGATTGTGGTTCGG + Intergenic
1038274488 8:26109185-26109207 GAATCTCTAGGGTTTTTGGTAGG + Intergenic
1038523913 8:28257119-28257141 TCCTCTCTCGGGTTTAGAGTGGG + Intergenic
1039741610 8:40388119-40388141 ACCTCTCTTGGGGTCTGGATTGG - Intergenic
1040632242 8:49228971-49228993 ACTTATCTAGGTTTTTTGGTGGG - Intergenic
1041246085 8:55889654-55889676 ACTTTGCTAGGGTTGTGGGTGGG + Intronic
1043004220 8:74797832-74797854 AGCTCTCTTGGGTTTTGGATTGG - Intronic
1044439739 8:92209187-92209209 CCCTCTCTTGGGTTCTGGATGGG - Intergenic
1044948429 8:97413151-97413173 ACCTCTCTGTGGTTTAGGGAAGG + Intergenic
1044986863 8:97763518-97763540 CCCTCTCTTGGGTTCTGGATTGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1046924536 8:119771756-119771778 ACCTATCTAGTGTTTTCAGTGGG - Intronic
1048018702 8:130519607-130519629 CCCTGTTTAGGGTTTGGGGTGGG + Intergenic
1049211738 8:141389812-141389834 ACCTCTCTGAGATTTTGGGCAGG + Intergenic
1051594803 9:18814096-18814118 ACCTCACTGTGGTTTTGGTTTGG + Intronic
1052971884 9:34381569-34381591 ACCTCTCCAGGGCTCTGTGTTGG + Intronic
1054962925 9:70989557-70989579 CCTTCTGTAGGGTTTGGGGTGGG + Intronic
1056054916 9:82811518-82811540 CCCTCTCTTGGGTTCTGGATCGG + Intergenic
1057232776 9:93334890-93334912 AGCTTTCTAGGGTTTTGCTTGGG + Intronic
1057252737 9:93516731-93516753 AGCTTTCTAGGGTTTTGCTTGGG - Intronic
1185839475 X:3375289-3375311 CCCTGTCTAGGGTTAGGGGTAGG - Intergenic
1187893492 X:23959599-23959621 ATCTCTCTGGGATTTTGGTTAGG + Intergenic
1189351551 X:40279459-40279481 GCATCTCTGGGTTTTTGGGTGGG + Intergenic
1191913567 X:66177748-66177770 TCATCTCTAGGGTTTGGGTTTGG + Intronic
1195440177 X:104889948-104889970 ACCTGTCTTGGGTTGGGGGTAGG - Intronic
1200139274 X:153890494-153890516 ACCTCTCAAAGGTTCAGGGTAGG + Intronic