ID: 1014241599

View in Genome Browser
Species Human (GRCh38)
Location 6:119023781-119023803
Sequence TTGTGAGAAAAATCAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014241599_1014241602 26 Left 1014241599 6:119023781-119023803 CCTGTCATTGATTTTTCTCACAA 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1014241602 6:119023830-119023852 AAAAAAAAAAAAAGTCTAAGTGG 0: 1
1: 64
2: 612
3: 4078
4: 23889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014241599 Original CRISPR TTGTGAGAAAAATCAATGAC AGG (reversed) Intronic
901240733 1:7691682-7691704 CTGTGTGAAAAGTCAATGGCAGG + Intronic
901948145 1:12720154-12720176 ATTTGAGAAAAATCAATGAGAGG + Intronic
903629202 1:24753881-24753903 CTGTTAGAAAAAACAAAGACGGG - Intronic
903912932 1:26741566-26741588 TTGTGAGAAAAAGGAATCAAAGG + Intronic
903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG + Intronic
904981936 1:34511337-34511359 CCATGAGAAAAATCAATGAGTGG + Intergenic
905631679 1:39522286-39522308 TTGTCAAATAAATGAATGACAGG - Intronic
905666074 1:39763886-39763908 TTGTCAAATAAATGAATGACAGG + Exonic
905719805 1:40187856-40187878 TAGGCAGAAAAATCAAAGACAGG + Intronic
905956386 1:42000734-42000756 TTGGGAGAAAAATCTTTGTCAGG - Intronic
907168551 1:52438172-52438194 TTTTGAGGAAAATAAATGAGAGG - Intronic
907726650 1:57026387-57026409 ATGAGAGAAAAACCAATGATGGG - Intronic
908518112 1:64914094-64914116 TTTTGAGAAAGACCAATGTCAGG + Intronic
909669493 1:78172111-78172133 TTGAGAGGAAGATCAAGGACAGG + Intergenic
910432122 1:87169222-87169244 ATATGAGAAAAATTAATGCCTGG + Intergenic
910580756 1:88821834-88821856 TTGTGAAATAAATTAATGATAGG + Intronic
910584532 1:88864756-88864778 TGGTGAGAAAGCTCAATGTCTGG + Intronic
911479261 1:98416960-98416982 TTCTAAGAAAAATCAATAAATGG + Intergenic
911558739 1:99378534-99378556 TTTTGAGAAATATCAGTCACTGG - Intergenic
911578794 1:99611243-99611265 TTGAGAGAAGAATCAAAGAGTGG - Intergenic
911941588 1:104054443-104054465 TTGTCAGAGAAATAAATGAGAGG - Intergenic
912580728 1:110718725-110718747 TTGCAAGAAAAATGATTGACTGG + Intergenic
913591251 1:120328641-120328663 TTGTGAAAAAAATGAATAAAGGG + Intergenic
913652114 1:120926458-120926480 TTGTGAAAAAAATGAATAAAGGG - Intergenic
914168993 1:145202612-145202634 TTGTGAAAAAAATGAATAAAGGG + Intergenic
914524114 1:148446567-148446589 TTGTGAAAAAAATGAATAAAGGG + Intergenic
914599562 1:149189304-149189326 TTGTGAAAAAAATGAATAAAGGG - Intergenic
914642291 1:149620569-149620591 TTGTGAAAAAAATGAATAAAGGG - Intergenic
914721693 1:150294518-150294540 TTTTGAGAACAATCAACGAAAGG - Intronic
916385899 1:164268925-164268947 TTATTAAGAAAATCAATGACTGG + Intergenic
916465959 1:165074985-165075007 TTTAGAGAAATATCTATGACTGG - Intergenic
917841842 1:178986634-178986656 TTCTGAGAAAAATGAGTGATGGG - Intergenic
921275832 1:213518980-213519002 TTGTAAGAAAATTTAATTACTGG + Intergenic
921437967 1:215149127-215149149 GTGTGAGAAAAAACACAGACAGG + Intronic
921747859 1:218758144-218758166 TTTTGAACAAAATCAATGCCTGG - Intergenic
922132020 1:222789187-222789209 TTATGTGACAAATCAAGGACAGG - Intergenic
924046968 1:240041753-240041775 CTGTGAGGAAAATTAATGTCTGG + Intronic
924259374 1:242213777-242213799 TGGTGGGAAAAATAAATAACTGG - Intronic
1063560680 10:7123631-7123653 TTTTGAGACATATAAATGACAGG - Intergenic
1064904852 10:20334661-20334683 TTGAAAGAAGAAACAATGACAGG + Intergenic
1065116397 10:22487360-22487382 TTTTGAAGAAAATCTATGACAGG - Intergenic
1065372797 10:25006930-25006952 TTGTGAAAAAGATCAATAACTGG + Intronic
1066081002 10:31929690-31929712 GTGTGAGAAAAATAACTGAGAGG + Intergenic
1066514516 10:36142304-36142326 TTGTGAGTAAAAACGATGTCTGG - Intergenic
1067013398 10:42736212-42736234 TTGTGTTAAAAATTAATGAAAGG - Intergenic
1067482352 10:46611172-46611194 TTTTGAAATAAATGAATGACAGG - Intergenic
1067612397 10:47730492-47730514 TTTTGAAATAAATGAATGACAGG + Intergenic
1068133365 10:52923416-52923438 TTGAGTAAAAAATAAATGACAGG + Intergenic
1069250178 10:66257306-66257328 CTGTGAGAAAAATGGAGGACTGG - Intronic
1071030786 10:81178424-81178446 TGTTCAGAAAAATAAATGACAGG + Intergenic
1071627818 10:87190739-87190761 TTTTGAAATAAATGAATGACAGG + Exonic
1071882379 10:89913370-89913392 TTCCAAAAAAAATCAATGACAGG + Intergenic
1072052518 10:91720314-91720336 TTGAGAAAAAAATCAATGTGGGG + Intergenic
1072994838 10:100233656-100233678 GTGTGAGAAAGATCAGAGACTGG + Intronic
1073828221 10:107351231-107351253 TTTTGAGAAATTTCAATGAGGGG - Intergenic
1074596466 10:114872338-114872360 TTATGAGAAAACGCATTGACTGG - Intronic
1075189287 10:120291640-120291662 TTCTGGGGAAAAACAATGACCGG - Intergenic
1075551298 10:123394747-123394769 TTGTGAAAAAAAGAAATCACTGG + Intergenic
1075920577 10:126209458-126209480 TGGTGAGAAAAATAAATCACTGG + Intronic
1077705706 11:4483066-4483088 GGGTTAGAAAAAGCAATGACAGG - Intergenic
1077729626 11:4716035-4716057 TTGTGAGAAGAACACATGACTGG + Intronic
1079807367 11:24950212-24950234 TGGTGAGACAAATAAATGAATGG + Intronic
1080207127 11:29743206-29743228 TTTGGACAAAAATCACTGACAGG + Intergenic
1083249029 11:61453081-61453103 TAGGGAGAAAAATCACTGACTGG + Intronic
1084066734 11:66708590-66708612 TTGTGAAAAAAATAAAAGAAGGG + Intronic
1086020594 11:82224757-82224779 TTTTGAAATAAATCAATGAGAGG - Intergenic
1086034227 11:82397084-82397106 TTGTGATAAAAATGATTGAGTGG - Intergenic
1086096914 11:83059865-83059887 TTGTGAGAAAAAGAAATCATGGG + Intronic
1086510942 11:87557217-87557239 GAGTGAGAAAAATCTATGCCTGG - Intergenic
1088386888 11:109268452-109268474 TTCTGAGAAAGCTTAATGACTGG + Intergenic
1089005640 11:115088498-115088520 TGGTGAGTGAAATAAATGACAGG - Intergenic
1089464974 11:118679169-118679191 TTTTGGTAAAAATCAATGACAGG + Intronic
1091302889 11:134518871-134518893 TTAAGAGAAAAAGCAGTGACTGG - Intergenic
1092383516 12:8018177-8018199 TTCTTAAAAAAATCAATGAAGGG + Intergenic
1092861023 12:12718763-12718785 TTATTAGAAAAAACAATGGCTGG - Intronic
1093241744 12:16685113-16685135 TGATGAGAAAAATCAAAGAAGGG - Intergenic
1094533959 12:31304669-31304691 GTGTCAGAAAAATCAATCTCTGG + Intronic
1095050460 12:37549618-37549640 ATGTGGGAAAAATCAATCAAAGG - Intergenic
1095466162 12:42490060-42490082 AAGTGAGGAAAATAAATGACTGG + Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1096763664 12:53865022-53865044 TAGTCAGAGAAATCATTGACTGG + Intergenic
1098007205 12:66010226-66010248 TCATGAGAAAAATTAAAGACAGG + Intergenic
1098849717 12:75581188-75581210 ATGTGAAAAAAATGAATGTCTGG + Intergenic
1100588830 12:96005103-96005125 TTTTGAGATAAACCAATGACTGG - Intronic
1102601458 12:114033859-114033881 TTGATAGAAAAATCAATACCAGG + Intergenic
1103501638 12:121407572-121407594 TTTTGAGAAAACTCAATTCCTGG - Intronic
1106294765 13:28401799-28401821 GTATGAGACAAATCCATGACAGG - Intronic
1106596129 13:31139825-31139847 TTATGAGATGAAACAATGACAGG + Intronic
1106823848 13:33497075-33497097 TTTTGAGAAGAATAAAAGACAGG + Intergenic
1107312662 13:39096040-39096062 CTGTGAGAGTAATCACTGACAGG + Intergenic
1107348056 13:39484388-39484410 TTGTTAGAAAATTTAATGAGAGG + Intronic
1108898580 13:55367013-55367035 TTGAGAAAAAAAATAATGACAGG - Intergenic
1108974425 13:56420303-56420325 TTGTTAGAGTAATCAATGTCTGG - Intergenic
1112372439 13:98805732-98805754 TTATGGGAAAAATGAATGATAGG - Intronic
1113173938 13:107538963-107538985 TTGAGAGCAAAATGAATGAATGG - Intronic
1113837734 13:113339584-113339606 TTGTGAGATATATCAATTAATGG - Intronic
1114222346 14:20708120-20708142 TTCTCAGAAAAATCACTGAGGGG - Intergenic
1115111980 14:29835221-29835243 TGGTAAGCAAAATCAATGAAGGG - Intronic
1116056423 14:39869803-39869825 TTGTGTGTGAACTCAATGACAGG - Intergenic
1120355094 14:83422466-83422488 TTGTAAGAAAGGTCAAAGACAGG + Intergenic
1121002577 14:90462986-90463008 TTTTGTGCCAAATCAATGACAGG + Intergenic
1121968351 14:98331471-98331493 TTGTTAGAAACACCAATCACAGG + Intergenic
1123027624 14:105434957-105434979 TGGGAAGAAAAATCAATGAAAGG - Intronic
1202915419 14_GL000194v1_random:166203-166225 ATGTGACAAAATTCAATGGCAGG - Intergenic
1202877319 14_KI270722v1_random:16842-16864 ATGTGACAAAATTCAATGGCAGG + Intergenic
1123894614 15:24816217-24816239 GAATGAGAAATATCAATGACAGG + Intergenic
1124907419 15:33884050-33884072 GTTTGAGAAAAATCGATGCCAGG - Intronic
1125229880 15:37441563-37441585 TACTGAGAGAAATCAATTACAGG + Intergenic
1129432299 15:75508414-75508436 TTCTGAGAAAAAAAAATGCCAGG + Intronic
1132186074 15:99802855-99802877 TTGTGAGAAAAACAAATTCCAGG - Intergenic
1133584947 16:7184105-7184127 ATGTGTGTAAAATCACTGACAGG + Intronic
1140017511 16:71201803-71201825 TTGTGTCAAAAAACATTGACTGG - Intronic
1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG + Intronic
1141432564 16:83978045-83978067 TTGAGAGAAAATTCACTGGCAGG + Intronic
1143798255 17:9355997-9356019 CTGTGAAAAAAAGCAATGAATGG - Intronic
1144469685 17:15526840-15526862 ATGTGAAAAAAATAAATAACAGG + Intronic
1144558893 17:16305591-16305613 ATGAGAGAAAAAACAAAGACTGG + Intronic
1144610549 17:16709654-16709676 TTGAGAGAAAAAACAAAGAGTGG - Intronic
1144902195 17:18605739-18605761 TTGAGAGAAAAAACAAAGAGTGG + Intergenic
1144926664 17:18816814-18816836 ATGTGAAAAAAATAAATAACAGG - Intergenic
1144928869 17:18840213-18840235 TTGAGAGAAAAAACAAAGAGTGG - Intronic
1145130306 17:20340338-20340360 TTGAGAGAAAAAACAAAGAGTGG - Intergenic
1146106035 17:30038165-30038187 TTCTGAGAGAAGTCAATGCCTGG + Intronic
1146394375 17:32451475-32451497 TTCTGAGAAAAATCATGGAGAGG + Intronic
1146679824 17:34799005-34799027 TTGTGAGAAAACACAATGGTAGG + Intergenic
1149009738 17:51843378-51843400 GTGTAACAAAAATAAATGACAGG - Intronic
1152484968 17:80584609-80584631 TTGTGGGAAAAATGAAACACAGG - Intronic
1154021868 18:10670325-10670347 TTCTGAGAAGAATCATTGAATGG - Intronic
1156785552 18:40909672-40909694 TTGGAAGAAAAGTCAATGTCTGG - Intergenic
1156796412 18:41051633-41051655 TTGAGAGAATAATCATTGACTGG + Intergenic
1157455256 18:47822289-47822311 TTTAGAGAAAAAGCAATAACTGG - Exonic
1159330518 18:66988278-66988300 TGGTGAGGAAAATAAAGGACTGG - Intergenic
1159489348 18:69110304-69110326 TTCCGAGAAAAACAAATGACAGG - Intergenic
1159988747 18:74877027-74877049 TCGACAGAAAAATCAATGCCTGG + Intronic
1159994177 18:74946487-74946509 TTGTTAAAAAAATGAATCACAGG + Intronic
1160310486 18:77785539-77785561 TGGTGAGAACAATCAATGCGGGG + Intergenic
1160569176 18:79804766-79804788 ATGTGAGAAAAAGCAATAAAAGG - Intergenic
1165184196 19:34002705-34002727 TTGAGAGAAAAAGCAATGAGTGG + Intergenic
1168079994 19:54003070-54003092 GTATGAGAAAAATGTATGACAGG + Intronic
925275927 2:2648319-2648341 TTGTGAAAAAAATGAATGTATGG + Intergenic
926615036 2:14988483-14988505 CTGTGAGAAAAATCAATTTCAGG + Intergenic
927122097 2:19975083-19975105 AAGTGAGAAAAATCAATCCCTGG - Intronic
927286433 2:21361939-21361961 ATCTGAAAAAAATCAATGTCTGG + Intergenic
927506697 2:23619630-23619652 TTTGGTGAAAAATCAATGTCTGG + Intronic
927523872 2:23720151-23720173 TTGTGGGAAGAATGAATGCCAGG - Intergenic
928163516 2:28951593-28951615 TTCTGAGAAAAATAAATAGCTGG + Intergenic
928807180 2:35173805-35173827 ATATGATAAAAATGAATGACTGG - Intergenic
929982023 2:46690145-46690167 TTGTAAGAAATAGCAACGACTGG + Intergenic
930409478 2:51006112-51006134 TTATAAGAAATGTCAATGACTGG - Intronic
930864428 2:56108598-56108620 AAGGGAGGAAAATCAATGACGGG + Intergenic
932565104 2:72901244-72901266 TTGTGAGCAAAAGCACTGAGCGG + Intergenic
932578554 2:72977583-72977605 TTGTGAGAAAAACAAGTCACAGG - Intronic
932855299 2:75227486-75227508 TTGTGACAAAAAGAAATGTCTGG - Intergenic
932936095 2:76103369-76103391 TTGAAAGAAAAACGAATGACTGG - Intergenic
933484902 2:82908860-82908882 TTGTCAAAAAAATCAATAAATGG + Intergenic
935523307 2:104136353-104136375 TTTTGTGAAAAATAAATGAAAGG - Intergenic
936562275 2:113551208-113551230 TGGTGAAAAACAGCAATGACTGG + Intergenic
937409458 2:121660365-121660387 CTGTGAGAAAAATCAAGAATAGG - Intergenic
939076988 2:137615334-137615356 TTGTTAGAAAAAAGACTGACAGG + Intronic
939568311 2:143810970-143810992 TTGTGAGAAATTACAATGCCCGG - Intergenic
940049325 2:149445402-149445424 TAGAGAGAAAAGTCAATGCCTGG - Intronic
943105355 2:183539985-183540007 TTGTGAAAACATTCAATGCCTGG - Intergenic
944682762 2:202091930-202091952 CTGAGAGTAAAACCAATGACTGG - Intronic
947106340 2:226671823-226671845 TATTGAGAAAAATTAATGGCTGG - Intergenic
947313000 2:228824386-228824408 TTGAAAGAAACAACAATGACAGG - Intergenic
947354073 2:229273852-229273874 TTGGGAGCAAAATCTATGAGTGG - Intergenic
947428176 2:230002677-230002699 TTGAGAAAAAAATTAATGCCGGG - Intronic
948270788 2:236671823-236671845 ATGGGAGACGAATCAATGACAGG - Intergenic
948719789 2:239892229-239892251 CAGAGAGAAAAATCGATGACGGG - Intergenic
948841167 2:240649804-240649826 TTGGGAAAAAGATCAATGAGAGG + Intergenic
1169379285 20:5093005-5093027 AGGTGAGAAAAAGAAATGACAGG + Intronic
1169785687 20:9357221-9357243 CTGTGAGAATAATCAATGACGGG - Intronic
1170335462 20:15265980-15266002 TTGTTAGAAAACACAATGAAGGG + Intronic
1174211146 20:48878960-48878982 TTGTGAGTAAAATCAGTGCCAGG + Intergenic
1175682941 20:61004497-61004519 TTATGAGCAGAATCAATGATAGG + Intergenic
1176634770 21:9180847-9180869 ATGTGACAAAATTCAATGGCAGG - Intergenic
1177599632 21:23293805-23293827 AAATGAGAAAAATCAATGAATGG + Intergenic
1178459389 21:32788588-32788610 TTGTGAGAAAAATGAGTTAGGGG - Intergenic
1180173520 21:46074847-46074869 TTATGAGAAAAATAAATAAAAGG + Intergenic
1184935561 22:47717804-47717826 GTGGGAGAAAAATAAATGTCAGG - Intergenic
951214410 3:20010393-20010415 TTGTGATAAAATTAAATAACAGG - Intronic
951382150 3:21996489-21996511 TTGTGGAAGAAATAAATGACGGG + Intronic
951430506 3:22601468-22601490 TTGTAAAAAAAATAAATGATTGG + Intergenic
952528982 3:34243776-34243798 CTTTGAGAAAAATCATTGAGCGG - Intergenic
954074348 3:48166360-48166382 TTGTGTGAAAATTAAATGTCAGG - Intronic
954845844 3:53555217-53555239 TTGTGAGATGAATCAATGCTGGG + Intronic
954966425 3:54615489-54615511 TTGTGAGAAAAATAATGGAGAGG + Intronic
956241398 3:67134724-67134746 GTGTGAGAAGAATGAAGGACAGG + Intergenic
957401329 3:79718500-79718522 TAGTGAGAAAAATCAAAGAATGG - Intronic
957404438 3:79758921-79758943 TTGTGACAAAAACCATTAACTGG + Intronic
957748363 3:84375633-84375655 TTGAGTGAAAAATAAATGACTGG + Intergenic
957748814 3:84384070-84384092 GAGTGAGAAAAATAAATGATAGG + Intergenic
957751920 3:84431221-84431243 TTGTGAGAAAAATAAGTGTCTGG + Intergenic
958807656 3:98831382-98831404 TTTTGAAAAAAATTAATGATAGG - Intronic
960677106 3:120205756-120205778 TTTTGAGAAAAATAAAGCACAGG - Intronic
960736713 3:120789090-120789112 TTCTAAGAAAAATCAATTAAGGG - Intergenic
962903372 3:139780016-139780038 TTGTGAGAAAAAAAAAAGAATGG + Intergenic
962923843 3:139974196-139974218 TTGTGGGAAACTGCAATGACAGG + Intronic
965507958 3:169536847-169536869 ATGTTAGAAAAATCAATTACAGG - Intronic
966367834 3:179209755-179209777 TTGTGAAAAAATTCAATCAGCGG - Intronic
970078860 4:12256575-12256597 TTGTGAGAAATATATATTACAGG - Intergenic
971922467 4:32959755-32959777 TTATGAGTAACATCTATGACAGG - Intergenic
972104735 4:35469069-35469091 TTGTGAGAGAAAACAATCAAGGG + Intergenic
972397530 4:38670839-38670861 TTGTGAGATGAATAAATGAATGG - Intronic
973712137 4:53640791-53640813 TTTTGTGAAAAATCAGTTACTGG - Intronic
973845351 4:54906842-54906864 TTATGAAAAAAAACAAAGACAGG + Intergenic
973865345 4:55107438-55107460 TCGGGAGAAAAACCAAAGACTGG + Intronic
974090863 4:57309973-57309995 TTCTGAGAATGATCAATAACTGG + Intergenic
974795260 4:66740911-66740933 TTGTCAGATTAATCAATGACAGG - Intergenic
975096283 4:70460834-70460856 TTGTGAGAGAACACAATCACAGG - Intronic
975332420 4:73132801-73132823 TATTCAGTAAAATCAATGACTGG + Intronic
976271264 4:83232517-83232539 TTGTGGGAAAGAATAATGACTGG + Intergenic
976965241 4:91031212-91031234 TTATGTGAAAAATTAATTACAGG - Intronic
977824862 4:101518853-101518875 TTGTTAGAAGAATCAGTGTCAGG - Intronic
978687723 4:111467464-111467486 TTGTGAGAGCATTCTATGACAGG - Intergenic
980721760 4:136706647-136706669 TAGTGAGCAAAATCAATATCAGG + Intergenic
980824950 4:138062010-138062032 TTTTGAAAAAACTCAAAGACAGG - Intergenic
981230680 4:142351358-142351380 TTGTTAATAAAATCAATGAAAGG - Intronic
982724977 4:158896681-158896703 ATGTAAGAATAATCTATGACAGG - Intronic
983422521 4:167537947-167537969 TTTATAGAAAAAGCAATGACAGG - Intergenic
983587214 4:169368977-169368999 TAGGGAGAAAAATCAATCAATGG - Intergenic
985031268 4:185792987-185793009 TTGTGTGAATAGTCAATGAGAGG + Intronic
985131180 4:186740312-186740334 TTGTGAGAAATGCCAATGTCTGG + Intergenic
986979971 5:13436073-13436095 TTGTGTGAAAAAGGAATGAAAGG - Intergenic
987134824 5:14890785-14890807 TTGTGAAAAAAGTCAACAACTGG - Intergenic
988113226 5:26850708-26850730 TTAAGAGAAAAATAATTGACAGG + Intergenic
988136748 5:27182239-27182261 CATTGAGAAAAATCAATAACTGG + Intergenic
988232673 5:28501245-28501267 TTTTTAGAAAAATCATTAACAGG + Intergenic
990519554 5:56565636-56565658 TGGTGAGAAAAAAAAATGAGAGG - Intronic
991077983 5:62563283-62563305 TTGTTAGATAAATTAATGAATGG + Intronic
991329192 5:65474385-65474407 TTGTCAGAAAAAAAAATGATAGG - Intronic
991942773 5:71868948-71868970 TTTTTAAAAAAATCAATGAAAGG - Intergenic
992535250 5:77695001-77695023 ATATGTGAAAAATCAGTGACAGG + Intronic
993393200 5:87347376-87347398 TAGTAAGAATAAACAATGACAGG - Intronic
993891190 5:93475636-93475658 TTATGACAAAAATTAATGACAGG - Intergenic
994194615 5:96908354-96908376 TAGTGAGAAGAATAAATAACAGG - Intronic
994200216 5:96965922-96965944 CTGTGAAAAAGATCAAGGACAGG - Intronic
994993567 5:107030227-107030249 ATGACAGAAAAATAAATGACAGG + Intergenic
995482937 5:112610720-112610742 TTGGAAGAAAAAAAAATGACTGG + Intergenic
995634459 5:114170261-114170283 TTGTGAGGTAAATGAATGATTGG - Intergenic
996760785 5:126984092-126984114 TTGTGGGAAAAGACAATGCCTGG + Intronic
997723612 5:136101593-136101615 TTGTGGGAAAATTCAAAGTCAGG - Intergenic
998831479 5:146164210-146164232 TTGTAAAAAAAATCCATGTCTGG + Intronic
1000206317 5:159063094-159063116 TTGTGAAAAGAAGGAATGACAGG - Intronic
1001270964 5:170311425-170311447 GTGGGAGAAAAAGCAATGAATGG + Intergenic
1003201280 6:3963448-3963470 ATGTGAGAAAAATCGATGGGAGG + Intergenic
1006484457 6:34327230-34327252 TTATCAGAAAGATCAAAGACAGG + Intronic
1008443776 6:51563758-51563780 TTGTCACAAAAATCAATTTCAGG + Intergenic
1009939918 6:70279775-70279797 TTGAAAGAAAAATAAATAACTGG - Intronic
1010163430 6:72886770-72886792 CTGAGAGAAAAATTACTGACAGG + Intronic
1011819912 6:91240868-91240890 TTGTCAGAAAAAAAAATCACTGG + Intergenic
1012206631 6:96469001-96469023 TGCTGAGAAAAATCAAGGACTGG - Intergenic
1012663803 6:101940339-101940361 TGGTAATAAAAATCAATGAAAGG - Intronic
1012964702 6:105661046-105661068 TTAAGAGAAGAATCAAAGACCGG + Intergenic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1014398889 6:120962750-120962772 GAGTAAGAAAAATCAATGATTGG + Intergenic
1014617605 6:123623085-123623107 TCTTGAGAAAAATCAGTGAAAGG - Intronic
1014715320 6:124857957-124857979 TAGTGAGCAAACACAATGACAGG - Intergenic
1015067109 6:129043622-129043644 TTATGAGAAAAAGCAATCAACGG - Intronic
1015781628 6:136873613-136873635 TTTTAAGAAAAATCAATTAGAGG - Intronic
1016141401 6:140616211-140616233 TTTTTAGAAAAAACAATTACAGG - Intergenic
1016972719 6:149779466-149779488 TTGTGGGACAAATCAGAGACGGG - Intronic
1017126701 6:151071391-151071413 CTGTGAGAAAAATCACTAATGGG + Intronic
1017970105 6:159304653-159304675 TTAGGAAAAAAATGAATGACGGG + Intergenic
1018368728 6:163148942-163148964 TTTTGTGAAAAATCTATGGCGGG + Intronic
1018513520 6:164552751-164552773 TTTAGAGAAAAATTACTGACAGG - Intergenic
1019957754 7:4429207-4429229 TTTTGAAAAAAATCACTAACTGG - Intergenic
1020577738 7:9955559-9955581 TTGTGGGAAAAAGCAATGCTGGG + Intergenic
1024089710 7:45925026-45925048 TTGTGAGAGAAAGCCATGACAGG - Intergenic
1024864674 7:53891660-53891682 TTGTGGGAAAATTCATTTACTGG - Intergenic
1026111929 7:67465338-67465360 TTTTTCGAAAAATCAATGCCTGG - Intergenic
1031001449 7:116420097-116420119 CTGTAAGAAAAATCAAAGACTGG - Intronic
1031658827 7:124395238-124395260 TTTTCAGTAAAATCAATGAATGG + Intergenic
1031762403 7:125730238-125730260 TTGTGAGAAAAATCACTGGCTGG - Intergenic
1032129701 7:129218033-129218055 TAGAGAGAAAAATCAAAGGCGGG - Intergenic
1032278764 7:130484168-130484190 TTTTAAGAAAAATCTATTACTGG + Intergenic
1032699881 7:134370294-134370316 TTGTCAGAAATGTCAAGGACTGG + Intergenic
1032932255 7:136686999-136687021 TTGGGAAAAAAATAAATAACAGG + Intergenic
1037279746 8:17225710-17225732 TTAATAGAAAAATAAATGACAGG + Intergenic
1038954938 8:32457449-32457471 TGGAGAAAAAAATCAGTGACAGG - Intronic
1039472847 8:37824907-37824929 TTGTGAGCAGAAGCAATGAAAGG - Intronic
1039871523 8:41549855-41549877 TTCTGAGAAAAATTTATTACAGG - Intergenic
1041222479 8:55665477-55665499 ATGGAAGAGAAATCAATGACGGG + Intergenic
1041456029 8:58061089-58061111 ATGTGATATAAATCAATGCCAGG - Intronic
1042983245 8:74554285-74554307 TTGTGAGAAAAAGTAATGTATGG + Intergenic
1043166412 8:76908414-76908436 ATGTTAGAAAAATAAATGCCTGG - Intergenic
1043304332 8:78775689-78775711 TTATGAGAAAATTCAAGGAGAGG - Intronic
1043697461 8:83238169-83238191 TTGTGTCTTAAATCAATGACAGG + Intergenic
1043750688 8:83929803-83929825 TTGTGAGAAAAAAAAGAGACAGG + Intergenic
1044536385 8:93361068-93361090 ATGTGGGAAAAATCATTGCCGGG + Intergenic
1045620385 8:103970533-103970555 TTGTAAGAGACCTCAATGACTGG + Intronic
1045906242 8:107348501-107348523 TTGGGGGAAAAATGAATGAAGGG - Intronic
1046803058 8:118449970-118449992 TTCAGAGAGAAATAAATGACAGG - Intronic
1047506903 8:125487330-125487352 TCGTAAGTAAAATAAATGACAGG + Intergenic
1047763762 8:127973266-127973288 CTGGGAGACGAATCAATGACAGG + Intergenic
1048296318 8:133217224-133217246 TTGTGTGAAGAATCAATGGAGGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049342657 8:142121467-142121489 GCGTGAGATAAATTAATGACGGG - Intergenic
1049890406 9:64124-64146 TGGTGAAAAACAGCAATGACTGG - Intergenic
1050745783 9:8874442-8874464 TTCTGGGAAAAACAAATGACTGG + Intronic
1051168757 9:14296146-14296168 TAGTGAAAAAAAGGAATGACTGG - Intronic
1051536244 9:18161566-18161588 TTTTGAGAAAGATCAAGAACTGG - Intergenic
1052460536 9:28757310-28757332 CTGTGAGAAGAATCAATGAGAGG - Intergenic
1053731869 9:41065307-41065329 TGGTGAAAAACAGCAATGACTGG - Intergenic
1054696588 9:68366411-68366433 TGGTGAAAAACAGCAATGACTGG + Intronic
1055318097 9:75054254-75054276 ATGTCAGTAAAATCAATAACTGG + Intergenic
1055470591 9:76606653-76606675 TAGTGAGCAAAATAAATGAATGG + Intergenic
1055589147 9:77791786-77791808 TTGTGAGAAAAACCTAGGAATGG - Intronic
1055989425 9:82089673-82089695 TAGTAAGAAAAGTCAATAACAGG - Intergenic
1060666256 9:125433736-125433758 TTGTCAGAAAAATGAATAAATGG + Intergenic
1061782595 9:133004661-133004683 TTCTGAGAAAGTTCAATGACAGG + Intergenic
1203757548 Un_GL000218v1:148156-148178 ATGTGACAAAATTCAATGGCAGG - Intergenic
1186754159 X:12652585-12652607 TTGTATGAAAAATCTAGGACTGG - Intronic
1186863295 X:13694485-13694507 CTGTGATAAAAATCAAGTACTGG - Intronic
1187967479 X:24626775-24626797 ATGTTAGAAAAATGAATTACGGG - Intronic
1189646713 X:43140805-43140827 TTGAGAAAAAAATCAATTTCTGG - Intergenic
1189944920 X:46168355-46168377 TTGTGAGCAAAATAAATGGTTGG - Intergenic
1190023608 X:46902341-46902363 ATATGATAAAAATCAATAACTGG - Intergenic
1190164683 X:48063241-48063263 TTGAGAGAAAAATCACTACCTGG + Intronic
1192102760 X:68282230-68282252 TAATGATAAAAATAAATGACAGG + Intronic
1192948522 X:75991334-75991356 TTATGAGAAAAGACAATAACAGG - Intergenic
1195307355 X:103597193-103597215 TTCTCAGTAAACTCAATGACTGG - Intergenic
1195455578 X:105065526-105065548 TTTTGAGAAAAATCAAAGATTGG + Intronic
1195467986 X:105201826-105201848 TTGTCAGAAAAATGAAAGCCTGG + Intronic
1196347841 X:114686991-114687013 TTGTGTGTAAAGTCAATGATGGG + Intronic
1196961098 X:121002221-121002243 TTGTGTGAAAATTAAATGACTGG - Intergenic
1198392019 X:136185727-136185749 TTTTAGGAAAAAACAATGACAGG + Intronic
1199357749 X:146881339-146881361 ATGTGTGAAAAATCAATTCCAGG - Intergenic