ID: 1014241599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:119023781-119023803 |
| Sequence | TTGTGAGAAAAATCAATGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 328 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 23, 4: 302} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014241599_1014241602 | 26 | Left | 1014241599 | 6:119023781-119023803 | CCTGTCATTGATTTTTCTCACAA | 0: 1 1: 0 2: 2 3: 23 4: 302 |
||
| Right | 1014241602 | 6:119023830-119023852 | AAAAAAAAAAAAAGTCTAAGTGG | 0: 1 1: 64 2: 612 3: 4078 4: 23889 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014241599 | Original CRISPR | TTGTGAGAAAAATCAATGAC AGG (reversed) | Intronic | ||