ID: 1014241599

View in Genome Browser
Species Human (GRCh38)
Location 6:119023781-119023803
Sequence TTGTGAGAAAAATCAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014241599_1014241602 26 Left 1014241599 6:119023781-119023803 CCTGTCATTGATTTTTCTCACAA 0: 1
1: 0
2: 2
3: 23
4: 302
Right 1014241602 6:119023830-119023852 AAAAAAAAAAAAAGTCTAAGTGG 0: 1
1: 64
2: 612
3: 4078
4: 23889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014241599 Original CRISPR TTGTGAGAAAAATCAATGAC AGG (reversed) Intronic