ID: 1014242707

View in Genome Browser
Species Human (GRCh38)
Location 6:119035317-119035339
Sequence TGTCCCTGAATTCCAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 1, 2: 18, 3: 137, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014242707 Original CRISPR TGTCCCTGAATTCCAGTGGG AGG (reversed) Intronic
900527540 1:3136479-3136501 TTTCCCTGAATTACAGAGCGGGG + Intronic
901091131 1:6642220-6642242 GTTCCCTCAATTCCAGTCGGAGG - Intronic
901119521 1:6879668-6879690 TGCCACTGCACTCCAGTGGGCGG - Intronic
902739327 1:18423877-18423899 TGTGCCTGAATTCCAAAGTGGGG - Intergenic
902980246 1:20117591-20117613 AGTCCATGAATTCAAGTGGGAGG + Intronic
903046742 1:20569970-20569992 TGTGCGTGAAGACCAGTGGGTGG + Intergenic
905103348 1:35545073-35545095 GGCCCCAGAAGTCCAGTGGGAGG + Intronic
905435839 1:37954621-37954643 TGTCCCAGCATCCCACTGGGAGG + Intergenic
908662088 1:66447730-66447752 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
909199884 1:72677684-72677706 TGTGCATAAATTTCAGTGGGAGG + Intergenic
910577151 1:88777784-88777806 AGTACCTGAATTCCAAAGGGAGG - Intronic
911646090 1:100338438-100338460 TGTACCTGAATTCTAAAGGGAGG + Intergenic
912940262 1:114038557-114038579 TGTGCCTGAATTCCAACAGGAGG - Intergenic
913652654 1:120933129-120933151 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
914080941 1:144411092-144411114 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914168446 1:145195920-145195942 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914175856 1:145279623-145279645 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914530575 1:148521108-148521130 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
914642837 1:149627250-149627272 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
915456145 1:156042087-156042109 AGTCCCTGAAGCCCAATGGGTGG - Intronic
915597561 1:156904263-156904285 CGTCCCTTAGTTCCTGTGGGAGG + Intronic
915632356 1:157162433-157162455 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
916843918 1:168629022-168629044 AGTCTCTGAATTCAAGGGGGAGG + Intergenic
916951153 1:169781582-169781604 TGTGCCTGAATTCCAAAGGGAGG - Intronic
917040202 1:170797329-170797351 TCTCCCTGACTTGCAGAGGGCGG - Intergenic
917257031 1:173126607-173126629 TGTGCCTGAATTGCAAAGGGAGG + Intergenic
917410080 1:174750289-174750311 TGTGCCTGAACTCCAAAGGGAGG + Intronic
918050808 1:180971107-180971129 TCTTCCTCACTTCCAGTGGGTGG + Intergenic
920795318 1:209131164-209131186 TGTTCCTGAATTCCAAAGGAAGG - Intergenic
921665830 1:217869697-217869719 GGTGCCTGAATTCCAAAGGGAGG + Exonic
921776077 1:219101721-219101743 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
922047925 1:221964719-221964741 TGTGCCTGAATTCCACAGGGAGG - Intergenic
922075196 1:222236684-222236706 TGTGCCTGAATTCCATAGGGAGG + Intergenic
922166475 1:223119574-223119596 TGTGCCTGAATTCCAAAGGGAGG - Intronic
922276404 1:224082867-224082889 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
922895105 1:229093804-229093826 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
923328787 1:232903482-232903504 TCTGCCTGAATTCCAAAGGGAGG + Intergenic
923803874 1:237237485-237237507 TGTGCCTGAATTCCAAAGGGAGG - Intronic
924287355 1:242501615-242501637 TGTCTATGAATTCCAATGAGAGG - Intronic
924573193 1:245256708-245256730 TGTGCCTGAATTCCAAGGGGAGG - Intronic
1063935626 10:11074940-11074962 TGTCCCCAAATTCCAGTAAGTGG - Intronic
1064452491 10:15455203-15455225 TGTGCCTGAATACCAAAGGGAGG - Intergenic
1064515562 10:16144115-16144137 AGTCCCTGAATACCTGTGTGGGG + Intergenic
1066192902 10:33072052-33072074 TGAGCCTGAATTCCAAAGGGAGG - Intergenic
1066541632 10:36453019-36453041 TGTTGCTGAATTCCATTGTGTGG + Intergenic
1067341462 10:45408629-45408651 TGTGCCTGAATTCCAAGAGGAGG + Intronic
1068063384 10:52098319-52098341 TGTCCCTGAATTACTGATGGAGG + Intronic
1068505370 10:57893551-57893573 TGTGCCTGGATTCCAAAGGGAGG + Intergenic
1068830181 10:61484998-61485020 GGTGCCTGAATTCCAATGGGAGG + Intergenic
1069248724 10:66243079-66243101 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1069875671 10:71561591-71561613 TGTCTCTGAATTGCACAGGGTGG + Intronic
1070439652 10:76430964-76430986 TGTCCCTGAAGTCTATTAGGTGG - Intronic
1071274476 10:84040519-84040541 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
1071287320 10:84161149-84161171 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1071710256 10:88042734-88042756 CATCCGTGAATTCCAGTTGGTGG + Intergenic
1071863043 10:89695543-89695565 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1073541627 10:104319873-104319895 TGTGCCTGAATTCCAGAGGGAGG - Intronic
1075022463 10:118961687-118961709 TGCCCTTGAATGCCAGTGTGAGG - Intergenic
1075226086 10:120630457-120630479 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1075489109 10:122850946-122850968 TGAGCCTGATATCCAGTGGGGGG - Intronic
1075574945 10:123571325-123571347 TGGGCCTCAACTCCAGTGGGAGG - Intergenic
1075732532 10:124644961-124644983 TCCCCCTGAATGCCAGGGGGAGG + Intronic
1076229595 10:128808998-128809020 TGTCCCAGCAGACCAGTGGGTGG - Intergenic
1076471648 10:130723255-130723277 TGTGCCTGAATTCCAGAGGAAGG + Intergenic
1076832493 10:133003313-133003335 TGTGCCTGAATTCCAAAAGGGGG + Intergenic
1077558193 11:3237600-3237622 TGTGCCTGAATTCCAAAGGCAGG + Intergenic
1077559192 11:3246788-3246810 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1078362638 11:10680974-10680996 GGTCAGTGAGTTCCAGTGGGAGG + Intronic
1078554112 11:12304707-12304729 TGTCACTGTAATACAGTGGGAGG - Intronic
1079884707 11:25972732-25972754 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1079893706 11:26092016-26092038 TGTGTCTGAATTCCAATGGGAGG + Intergenic
1080777669 11:35401472-35401494 TGTACCTGAATTCCAAAGGAAGG + Intronic
1081697901 11:45130006-45130028 TGCCACTGCAATCCAGTGGGTGG + Intronic
1081816655 11:45948089-45948111 TGTCCCTGAATTATAGTTGCAGG - Intronic
1082006670 11:47423061-47423083 TGTCCCTGAGTTAGAGTAGGAGG - Intronic
1083083105 11:60113977-60113999 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1083239595 11:61377611-61377633 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1084046445 11:66570999-66571021 TGTGCCTCAATTCCAAAGGGAGG - Intergenic
1084744640 11:71161139-71161161 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1084898741 11:72294266-72294288 TGTTCCAGATTTCCAGTGGCTGG + Intronic
1085489669 11:76903573-76903595 TGTGCCTAAACTCCAATGGGAGG - Intronic
1085619608 11:78027952-78027974 TGTGCCTGAATTCCAAAAGGGGG + Intronic
1085831031 11:79901138-79901160 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1085999873 11:81970174-81970196 TGTCTCTGCTATCCAGTGGGTGG - Intergenic
1086203829 11:84234678-84234700 TGTGCCTGAATTCCAACGGGAGG - Intronic
1086782273 11:90922176-90922198 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1087302876 11:96456244-96456266 TGTGCCTGAATTCCAAAGGAAGG - Intronic
1088079848 11:105898316-105898338 TGTTACTGGATTCCAGTTGGTGG + Exonic
1088330034 11:108641895-108641917 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1089175665 11:116547299-116547321 GGTCCCTGGATTGCAGTAGGTGG - Intergenic
1089744602 11:120607907-120607929 AGACCCTGGATTCCAGGGGGTGG + Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090086035 11:123652066-123652088 CCTGCCTGAATTCCAGTGGAGGG - Intronic
1090105718 11:123852075-123852097 TGGCCCTCAATTCCTGGGGGAGG - Intergenic
1090290061 11:125535394-125535416 TGTCCCTGAATTTCAAAGGGAGG - Intergenic
1090802899 11:130184831-130184853 TGTTCCTGAATGCTAGTGGCTGG + Intronic
1091386167 12:96732-96754 TGTGCCTGAATTCCTAAGGGAGG + Intronic
1091610436 12:2003477-2003499 TGTCTCTACATTCGAGTGGGTGG + Intronic
1092304045 12:7281310-7281332 TGTGCCTGAATTCCAAAGGGTGG - Intergenic
1092895620 12:13007470-13007492 TGTGCCTGAATTCCAAAAGGAGG - Intergenic
1093762316 12:22924222-22924244 TGTGCTTGAATTCCAAAGGGAGG - Intergenic
1095497608 12:42801782-42801804 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1097459765 12:59846627-59846649 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1098584491 12:72139882-72139904 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1098876594 12:75872164-75872186 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1099544112 12:83955087-83955109 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1099802019 12:87469522-87469544 TGTGCCTGATTTCCAAAGGGAGG - Intergenic
1100299102 12:93290802-93290824 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1101049067 12:100842072-100842094 TGTCCTTGGCTTTCAGTGGGGGG - Intronic
1101405217 12:104422648-104422670 TGTGCCTAAATTCCAATGGGAGG + Intergenic
1101480032 12:105087797-105087819 TGTCCCTGGAATGCAGTGGTGGG + Intergenic
1101537024 12:105627805-105627827 TGTGACTAAATTCCAGTGAGAGG + Intergenic
1102444409 12:112990822-112990844 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1102477987 12:113201256-113201278 TGTCCCTGACCTCCATTGTGGGG - Intronic
1102696706 12:114805482-114805504 TGTCCCAAACTTCCAGTGGGAGG - Intergenic
1103796613 12:123507365-123507387 TCTCCCTGTATTGCAGTGGCTGG - Intronic
1104355334 12:128080178-128080200 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1104530468 12:129565469-129565491 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1104694074 12:130850168-130850190 TTTTCCTGAATTCCAAAGGGAGG - Intergenic
1104914016 12:132255192-132255214 TGTTCCAGAATTCCAAAGGGAGG - Intronic
1105031733 12:132888675-132888697 TATACCTGAATTCCAAAGGGAGG - Intronic
1105383476 13:19909288-19909310 CATCACTGAATTCCAGTGGCAGG - Intergenic
1106434495 13:29711942-29711964 TGTTCCTGAATTCCAAAGGCAGG + Intergenic
1106656933 13:31756464-31756486 TGACCCAGAATTCCCTTGGGCGG - Intronic
1106927924 13:34632418-34632440 TGTGCCTGAATTCCAAAGGGGGG - Intergenic
1107021398 13:35756147-35756169 AGTCTCTGCATCCCAGTGGGGGG - Intergenic
1107117408 13:36762048-36762070 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1107911264 13:45107778-45107800 TGTGCCTGAATTTCAAAGGGAGG + Intergenic
1108298869 13:49054069-49054091 TGTGCCTGAACTCCAAAGGGAGG + Intronic
1108820907 13:54348427-54348449 AATCCCTGAATTCCAGTATGTGG - Intergenic
1109177641 13:59176079-59176101 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1109342524 13:61079208-61079230 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1110171578 13:72506933-72506955 TTTCCCTAAATTCCACTGGTAGG - Intergenic
1111136375 13:84050502-84050524 TGTCTCTGCATTCTAGAGGGAGG + Intergenic
1112185945 13:97127900-97127922 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1112234649 13:97624510-97624532 TGTCCCTTGGTTCCAGGGGGAGG - Intergenic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1112883518 13:104138521-104138543 TGGCCCTGAACACCACTGGGAGG - Intergenic
1112886665 13:104182019-104182041 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1113479778 13:110612013-110612035 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1113775228 13:112940535-112940557 TGTCCCTGAAACCCACTGAGAGG - Intronic
1113870697 13:113558155-113558177 TTTCCCTGGTTCCCAGTGGGCGG + Intergenic
1114426302 14:22626429-22626451 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG + Intergenic
1115019696 14:28661269-28661291 TGTCCCTGGATTCTGGTGGGTGG - Intergenic
1115060079 14:29176881-29176903 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1115933532 14:38526045-38526067 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1116045077 14:39733721-39733743 TGTCCCTGAAACCCTGGGGGAGG - Intergenic
1116395891 14:44448398-44448420 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1116978550 14:51142804-51142826 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1118158596 14:63266311-63266333 TGTGCCTAAATTCCAAAGGGAGG + Intronic
1118260588 14:64243178-64243200 TCTCCCAGAATTCCAGATGGTGG + Intronic
1118380421 14:65213531-65213553 TGTGCCTGAATTCCACAGGGAGG + Intergenic
1118441301 14:65814228-65814250 TGTGCCCGAATTCCAAAGGGAGG + Intergenic
1118491563 14:66265949-66265971 TGTCCCTGAATTCCAAAGAGAGG + Intergenic
1119635358 14:76268927-76268949 TGTCGCTGAATTCCCGTGAATGG - Intergenic
1120267997 14:82275733-82275755 TGTGCCTAAATTCCAGAGGAAGG + Intergenic
1120357770 14:83456385-83456407 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1121425008 14:93844327-93844349 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1122256998 14:100485699-100485721 TGTCCATGTGTTCCAGAGGGAGG + Intronic
1122988603 14:105225423-105225445 TGTGCCTGAACTCCAAAGGGAGG - Intronic
1123160358 14:106272631-106272653 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123178913 14:106448631-106448653 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123208012 14:106732365-106732387 TGTGCTTGAATTCCAAAGGGGGG + Intergenic
1123212965 14:106778420-106778442 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1123968208 15:25480000-25480022 GGTCCCTGAAGTCCTGTGAGTGG + Intergenic
1124027919 15:25983881-25983903 TGTGCCTGAATCCCAAAGGGAGG + Intergenic
1124208752 15:27744884-27744906 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1124245372 15:28066450-28066472 TGTGCCTGAATTCCAACGGGAGG - Intronic
1126525171 15:49645978-49646000 TGACCCAGAATCACAGTGGGGGG - Exonic
1127398348 15:58561829-58561851 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1127851348 15:62914678-62914700 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1128308260 15:66614126-66614148 TGTCCCTGAATGCTAGTGCCTGG - Intronic
1128380639 15:67109529-67109551 TGTCTTTGCATTCTAGTGGGTGG + Intronic
1128402275 15:67295625-67295647 TGTACCTGAAGTCCAGAGGTAGG - Intronic
1128735512 15:70051642-70051664 TTTCTCTGAAATCCAGGGGGAGG + Intronic
1129927086 15:79374323-79374345 TGTGCCTGAATTCCAAAGGAAGG + Intronic
1130014221 15:80174839-80174861 TGTCCCTGGATAGCAGTAGGGGG - Intronic
1130695053 15:86122839-86122861 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1131731749 15:95288866-95288888 TTTCCCTGAATTCAAGGAGGGGG + Intergenic
1133923147 16:10172580-10172602 TGTCCCAGGATGGCAGTGGGAGG + Intronic
1134002096 16:10790908-10790930 TGTGCCTGGATTCCAATGGGAGG + Intronic
1134126310 16:11618619-11618641 TGTCCCCGCCTCCCAGTGGGTGG + Intronic
1135314405 16:21432328-21432350 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1135323236 16:21510580-21510602 TGTACCTGAATTCCAGAGGGAGG - Intergenic
1135367327 16:21864604-21864626 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1135444486 16:22506554-22506576 TGTGTCTGGATTCCAGAGGGAGG - Intronic
1136289581 16:29263448-29263470 TGGGCCTGAATTCCATAGGGAGG + Intergenic
1136311074 16:29411023-29411045 TGTGTCTGGATTCCAGAGGGAGG + Intergenic
1136324518 16:29512814-29512836 TGTGTCTGGATTCCAGAGGGAGG + Intergenic
1136334720 16:29603767-29603789 TGTACCTGAATTCCAGAGGGAGG - Intergenic
1136439203 16:30252795-30252817 TGTGTCTGGATTCCAGAGGGAGG + Intronic
1136500501 16:30667658-30667680 TGTCCCTGACTTCCAGGAGATGG + Intronic
1137321018 16:47382547-47382569 TGTGCCTGGATTCCAGAGTGTGG - Intronic
1138031602 16:53563655-53563677 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1138212213 16:55173184-55173206 TGGCCCTGAAGTCAACTGGGAGG - Intergenic
1138261718 16:55628401-55628423 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1140199324 16:72881778-72881800 TGTCCCTGGATTTCACTGGAGGG - Intronic
1141411891 16:83840777-83840799 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
1142035436 16:87859603-87859625 TGTACCTGAATTCCAGAGGGAGG - Intronic
1142095317 16:88236428-88236450 TGGGCCTGAATTCCATAGGGAGG + Intergenic
1142582972 17:953046-953068 GGTCCCTGGAATCCAGTGAGGGG + Intronic
1144144053 17:12380259-12380281 TGTGCCTGAATTCCAAAGGCAGG - Intergenic
1144352543 17:14411626-14411648 CGTCCTTGAATTCCACTGGAAGG - Intergenic
1145027903 17:19482774-19482796 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1145031846 17:19510443-19510465 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1146677498 17:34783665-34783687 TGTCCCTGGCTTTTAGTGGGCGG - Intergenic
1146866218 17:36337177-36337199 TTCCCCTGGCTTCCAGTGGGTGG - Intronic
1147080614 17:38017326-38017348 TTCCCCTGGCTTCCAGTGGGTGG - Intronic
1147493797 17:40896416-40896438 TGTCACTGAACTCCAGTCTGGGG + Intergenic
1148951836 17:51320164-51320186 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1149845254 17:60005683-60005705 TTCCCCTGGCTTCCAGTGGGTGG + Intergenic
1150462178 17:65361964-65361986 TGCACCTGAATTCTGGTGGGGGG - Intergenic
1151407491 17:73898690-73898712 TGACCCTGAACCCCCGTGGGTGG - Intergenic
1151691612 17:75689658-75689680 TCTACCTGAAGGCCAGTGGGTGG + Intronic
1152137491 17:78513196-78513218 TGTGCCTGAATCCCAAAGGGAGG - Intronic
1152294043 17:79456403-79456425 TGCCCCTGGCATCCAGTGGGTGG - Intronic
1152871419 17:82755574-82755596 TGTGCCTGAATTCCAACGAGAGG + Intronic
1152887158 17:82859205-82859227 TTTCCCTGAAAGCCAGTGCGGGG - Intronic
1152887197 17:82859413-82859435 TTTCCCTGAAAGCCAGTGCGGGG - Intronic
1153121985 18:1739722-1739744 TGTGCCTGAATTCCAAAGGCAGG + Intergenic
1153432998 18:5039234-5039256 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1153741678 18:8136586-8136608 TGTCCCTAATTTCCAGTGTAGGG - Intronic
1155197094 18:23485573-23485595 TGTGCCTGAATTCCAAAGTGGGG - Intronic
1155474516 18:26224937-26224959 TGTCCCATAATTCCAGAGGTTGG + Intergenic
1155644253 18:28058348-28058370 TGCTCTTGAATCCCAGTGGGAGG + Intronic
1156133221 18:34003900-34003922 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1156151837 18:34252248-34252270 TGTACCTGAATTCCAATGGGGGG + Intergenic
1156185668 18:34660306-34660328 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1157876883 18:51282068-51282090 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1158164932 18:54529638-54529660 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
1158686557 18:59620238-59620260 TCTCGCTGTCTTCCAGTGGGGGG + Intronic
1159670489 18:71215170-71215192 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1159992690 18:74928728-74928750 TGTGCCTGAACTCCAAAGGGAGG + Intronic
1160543743 18:79639307-79639329 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
1161231591 19:3177431-3177453 TGCACCTCAATCCCAGTGGGGGG + Intronic
1163136487 19:15315163-15315185 TGGCTCTGAATACCTGTGGGGGG - Intronic
1164446790 19:28324486-28324508 TGTGCCTGAATTCCAATAGGGGG - Intergenic
1165391087 19:35539309-35539331 TATGCCTGAATTCCAAAGGGAGG + Intronic
1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG + Intronic
1167997975 19:53421894-53421916 TGTCCATTAATTCCTGTGGTAGG + Intronic
1168007402 19:53502184-53502206 TGTCCATTAATTCCTGTGGTAGG + Intergenic
1168180817 19:54662118-54662140 AGTCCCTGAAGGCCTGTGGGAGG + Exonic
1168584221 19:57579570-57579592 TGTGCCTGAATTCCAAGGGGAGG + Intronic
926382464 2:12304025-12304047 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
926661519 2:15472331-15472353 TGTCACTGAAACTCAGTGGGAGG - Intronic
927263936 2:21123830-21123852 TGTCCCTGGCTTCCTGAGGGCGG - Intergenic
928328766 2:30341217-30341239 TGTCACTGAACTCCAGTCTGGGG - Intergenic
929694549 2:44103013-44103035 TGTCCCTGTGATACAGTGGGGGG + Intergenic
931042180 2:58313094-58313116 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
932959721 2:76398350-76398372 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
933345384 2:81078497-81078519 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
933389088 2:81648594-81648616 TATGCCTGAATTCCAAAGGGAGG + Intergenic
933793959 2:85905464-85905486 TTTCCTTGCATTCCAGTGTGAGG + Intergenic
933935694 2:87201915-87201937 AGTCCCTGAGTGGCAGTGGGTGG - Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
934537248 2:95145286-95145308 TGTGCCTGAATTCCAAAGAGAGG - Intronic
934692236 2:96370582-96370604 GGTCTCTGACTTCCAGTGGTAGG - Intronic
934881355 2:97983304-97983326 GGTGCCTGAATTCCAAAGGGAGG + Intronic
935161825 2:100535967-100535989 TGTACCTGAATTCCAAAGGGAGG + Intergenic
935807299 2:106761641-106761663 TGTGCCTGATTTCCAACGGGAGG - Intergenic
936357455 2:111763910-111763932 AGTCCCTGAGTGGCAGTGGGTGG + Intergenic
936586436 2:113762544-113762566 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
937849626 2:126620938-126620960 TGTTACTGATGTCCAGTGGGTGG - Intergenic
938930019 2:136078534-136078556 TGTGCCTTAATTCCTTTGGGTGG + Intergenic
939423107 2:141999194-141999216 TGTGGCTGAATTCCAATGGGAGG + Intronic
942358710 2:175148592-175148614 TGTGCCTGAATTTCAACGGGAGG - Intronic
944646560 2:201786140-201786162 TGTCCCTGAATTTAAGGGGCAGG - Intergenic
945111336 2:206362932-206362954 TGTGCCTGAATTCCAGAGGGAGG - Intergenic
947433881 2:230055522-230055544 AGTCCCTGAATTCCAGACTGTGG - Intronic
947828686 2:233124192-233124214 TCTTCCTGAATTCCAGCAGGTGG + Intronic
948321039 2:237069936-237069958 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
948433877 2:237939038-237939060 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
948864165 2:240767077-240767099 CGTCCCTGGAGGCCAGTGGGTGG - Intronic
1168845854 20:944351-944373 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1169302819 20:4459297-4459319 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1170074563 20:12405490-12405512 TATGCCTGAATTCCAAAGGGAGG + Intergenic
1170186813 20:13600542-13600564 TTTTCCTGAATTCTAGTGTGAGG - Intronic
1170301029 20:14884734-14884756 TGTGCCTCAATTCCAAAGGGAGG - Intronic
1171165204 20:22964174-22964196 TGTGCCTGAATTCCAAAAGGAGG + Intergenic
1171235642 20:23522186-23522208 TGTTTCTGAATTCCAAAGGGAGG + Intergenic
1172034440 20:32001460-32001482 TGTCCCTGACTTCCGCTGAGGGG - Exonic
1172106881 20:32522343-32522365 TGTCCCTGACCTCCAGAGGAAGG - Intronic
1173746491 20:45441443-45441465 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1174543240 20:51306246-51306268 CGTGCCTGAATTCCAAAGGGCGG + Intergenic
1174544058 20:51312055-51312077 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
1175081092 20:56420821-56420843 TGGCCCTGACTCCCAGTGGCTGG - Intronic
1175500298 20:59445403-59445425 TGCAGCTGAATTCCAGTCGGAGG - Intergenic
1176362874 21:6012894-6012916 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1178516732 21:33254259-33254281 TGTGCCTGAATTCCAAAGGTAGG - Intronic
1179760644 21:43525651-43525673 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1180094166 21:45547413-45547435 TTTCCCTGAATTCCAAAAGGGGG - Intergenic
1180357439 22:11853964-11853986 TGTCCATAACATCCAGTGGGGGG + Intergenic
1180380828 22:12138367-12138389 TGTCCATAACATCCAGTGGGGGG - Intergenic
1182071132 22:27464513-27464535 TGTCACAGAATTCCAGAGGCAGG + Intergenic
1182501710 22:30752941-30752963 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1182784895 22:32899197-32899219 TGTGCCTGAATCCTAGCGGGTGG + Intronic
1183611155 22:38907249-38907271 TGTGCCTGAATTCCAAAGGAGGG - Intergenic
1183636635 22:39067636-39067658 TGTCCCTGAAGTCTTGTGGCAGG + Intronic
1183964231 22:41431776-41431798 TGTCCCTGCATCCCTGTGTGTGG - Intergenic
1184933352 22:47698434-47698456 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
949293604 3:2494833-2494855 TGTGCCTGAATTCCAAAGGGAGG + Intronic
950753843 3:15155765-15155787 AGTGCCTCAGTTCCAGTGGGAGG + Intergenic
951662685 3:25087174-25087196 TGTGGCTGAATTCCAAAGGGAGG + Intergenic
952033793 3:29175831-29175853 TGTACCTGAATTCCAAAGGGAGG + Intergenic
952666024 3:35905421-35905443 TGTGCCTGAATTCCAAAGAGAGG + Intergenic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
953294542 3:41700640-41700662 TGTCCCTGAAATCCATTAGCGGG - Intronic
953320020 3:41962976-41962998 TGTGCCTGTATTCCAACGGGAGG - Intergenic
953378206 3:42446618-42446640 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
953505412 3:43481539-43481561 TGGGCCTGAATTCCAAAGGGAGG - Intronic
953981288 3:47414446-47414468 TGTCCCTGTGCCCCAGTGGGTGG + Intronic
954773977 3:52999404-52999426 TGGCCCTGCATTCCAGGGTGGGG + Intronic
955909784 3:63847964-63847986 TGTGCCTGAATTCTAGAAGGAGG - Intronic
957128899 3:76198309-76198331 TGTGCCTAAATTCCAAAGGGAGG - Intronic
957607698 3:82423915-82423937 GGTCCTTGTATTCTAGTGGGAGG - Intergenic
959376581 3:105595149-105595171 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
960410243 3:117314233-117314255 TGTGCCTAAATTCCAAAGGGAGG - Intergenic
960569924 3:119175656-119175678 AGTCCCTGATTTCCAATGGGTGG + Intronic
961632180 3:128309180-128309202 AGGACCTGAATTCCGGTGGGTGG + Intronic
962749281 3:138421544-138421566 TGTGCCTGAATTCCAAAGAGGGG + Intergenic
963058091 3:141203996-141204018 TGTGCCTGAGTTCCAAAGGGAGG + Intergenic
963226615 3:142868954-142868976 TGTGCCTGGATTCCAAAGGGAGG - Intronic
963470400 3:145734726-145734748 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
963580635 3:147122689-147122711 TGTCCCTTGGTTCCTGTGGGAGG - Intergenic
963756446 3:149239525-149239547 TGTGCCTGAATTCCAAAGGGTGG + Intergenic
964733132 3:159888704-159888726 AATCACTGAATTGCAGTGGGTGG + Intronic
964751259 3:160056026-160056048 TCTCACTGAGTTCCAGTGGTAGG - Intergenic
965278230 3:166715584-166715606 TGTGCCAGAATTCCAATGAGAGG - Intergenic
965601800 3:170461951-170461973 TGTCCCTAACTTCCAATGGAGGG - Exonic
965959505 3:174412120-174412142 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
966392654 3:179468592-179468614 TGTGCCTGAATTCCAAAGAGTGG - Intergenic
966994586 3:185267231-185267253 TGTGCCTGAATTCCAAGGGGTGG - Intronic
969566270 4:7980241-7980263 TGTGCCTGAATTCCGAAGGGAGG - Intronic
969578398 4:8049532-8049554 TTTTCCTGAATTCCAAAGGGAGG - Intronic
969661515 4:8532385-8532407 TGTGCCTGAATTCCAAAGGGGGG + Intergenic
971277219 4:25209824-25209846 TGAGCCTGAATTCCAAAGGGAGG + Intronic
971689207 4:29811306-29811328 TGTGCCTGAAATCCAAAGGGAGG + Intergenic
971804325 4:31335952-31335974 TGTGCCTGCATTCCAAAGGGAGG + Intergenic
971851857 4:31994488-31994510 TGTGCCTGAATTCCAATAGGAGG + Intergenic
971878771 4:32340561-32340583 TGTGCCTGAATTCCAGCTGGGGG - Intergenic
971919280 4:32915572-32915594 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
971970406 4:33612441-33612463 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
972293426 4:37713629-37713651 TGTGCTTGAATTCCAAAGGGAGG + Intergenic
972322872 4:37988866-37988888 TGTGCCTGAATTCCAGAGAGAGG - Intronic
972840156 4:42921287-42921309 TGTCTCTGAGTTCTAGAGGGTGG - Intronic
973971459 4:56217704-56217726 TGTGCCTGAATTGCAAAGGGAGG + Intronic
974669854 4:65015363-65015385 TGTGCCTGATTTCCAAAGGGAGG + Intergenic
975138305 4:70895672-70895694 TGTCCTTGGATTCCAGTGGCAGG + Intergenic
975484995 4:74926158-74926180 TATGCCTGAATTCCAAAGGGAGG + Intergenic
976660392 4:87534652-87534674 TCTTCCTGACTTCCACTGGGTGG + Intergenic
976696044 4:87920649-87920671 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
976813398 4:89120700-89120722 TGTGCCTAAATTCCAAAGGGCGG - Intergenic
977622455 4:99153065-99153087 TGTGCCTGAATTCCAGGTGGGGG - Intronic
977681318 4:99801551-99801573 TGTGCCTGAATTCCAAAAGGTGG + Intergenic
978551159 4:109928813-109928835 TGTGCCTGAATTCCAACGGGAGG + Intronic
980212172 4:129803546-129803568 GGTCAGTGATTTCCAGTGGGAGG - Intergenic
980908709 4:138974627-138974649 TGTGCCTGAATTCCAAAGGTAGG - Intergenic
980982854 4:139669082-139669104 TATGCCTGAATTCCAAAGGGCGG + Intronic
981089203 4:140715207-140715229 TGTGCCTGAATTCCAAAGGAAGG + Intronic
981189643 4:141847065-141847087 TGTGCCTGAATTCTAAAGGGAGG - Intergenic
981312312 4:143309236-143309258 TGTGCCTGAATTCTACAGGGAGG + Intergenic
981422863 4:144571334-144571356 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
981903310 4:149891524-149891546 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
982009544 4:151093389-151093411 TGCACCTGAATTCCAAGGGGAGG + Intergenic
982415015 4:155120773-155120795 TGTGCCTGAATTCCAAAAGGAGG - Intergenic
982773152 4:159416487-159416509 TGTGCCTGGATTCCAGTGAGAGG - Intergenic
982787944 4:159558231-159558253 TGTACATGAATTCCAAAGGGAGG + Intergenic
985677824 5:1241399-1241421 TGTGCCTGGCATCCAGTGGGTGG + Intronic
985726504 5:1518725-1518747 TGGCCCTGTGTTCCAGTGGGAGG + Intronic
985789630 5:1918639-1918661 TGTCCCTGATCCCCAGAGGGAGG + Intergenic
986949564 5:13066376-13066398 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
987193291 5:15500509-15500531 GGTCCCCGCACTCCAGTGGGAGG - Exonic
987586128 5:19859231-19859253 TGTGCCTGAATTCCAAAGGGAGG - Intronic
987740353 5:21900234-21900256 TGTGCCTCAATTCCTGTGGAAGG + Intronic
988679732 5:33473186-33473208 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
990264374 5:54060032-54060054 TCATCCTGAATTCCAGTGGAAGG + Intronic
992439316 5:76784392-76784414 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
992541874 5:77774090-77774112 TGTTCCTGAGTTCCAAAGGGAGG - Intronic
993845615 5:92939563-92939585 CTTCCCTGACTGCCAGTGGGTGG + Intergenic
994198498 5:96945659-96945681 TGTGCCAGAATTCCAAAGGGAGG + Intronic
994392996 5:99207218-99207240 TGTTCCTAACATCCAGTGGGGGG - Intergenic
994416957 5:99484410-99484432 AGTCCCTGACTACCAGTGAGAGG + Intergenic
994463017 5:100090764-100090786 AGTCCCTGACTACCAGTGAGAGG - Intergenic
994867387 5:105293654-105293676 TGTTCCTGAATTCCAAAAGGAGG - Intergenic
995083464 5:108081196-108081218 TGTGCCTGAATTCCAAAAGGAGG + Intronic
995109828 5:108416861-108416883 TGTGCCTGAATTCCAATAGGAGG - Intergenic
995454140 5:112334085-112334107 TGTGCCTGAACTCCAAAGGGAGG - Intronic
996321543 5:122222553-122222575 AGTCTCTGGATTCCAGGGGGTGG - Intergenic
996708172 5:126518122-126518144 TGTGCCTGAATTCCAGTGGGAGG - Intergenic
996914982 5:128701818-128701840 TGCACCTGAATTCCAGCGGGAGG + Intronic
996998120 5:129724365-129724387 TATGCCTGAATTCCAAAGGGAGG + Intronic
998032629 5:138884682-138884704 TGTGCCTGAATTCCAAAGGGAGG + Intronic
998587667 5:143445237-143445259 TGTCACTGCATTCCAGCTGGGGG - Intergenic
998773368 5:145571363-145571385 TGTGCCTGAATTCCAAAGGGAGG - Intronic
999174687 5:149623741-149623763 TCTCCCTGAATCCTGGTGGGAGG + Intronic
1000061446 5:157660037-157660059 TGTGCCTGAATTCCAACGGGAGG + Intronic
1000095143 5:157965154-157965176 GTTCCCTGAATTCCAAAGGGAGG + Intergenic
1000481802 5:161785908-161785930 TGTGCCTGAATTCCAATGGGAGG + Intergenic
1000601028 5:163274661-163274683 TATGCCTGAATTCTAATGGGAGG + Intergenic
1001077005 5:168637455-168637477 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1001282492 5:170397100-170397122 TGTGCCTGAATACCAAAGGGAGG + Intronic
1001383859 5:171321825-171321847 TGTCCTTAAATTCACGTGGGGGG + Intergenic
1002407265 5:179044894-179044916 TGTGCCTAAACTCCAGAGGGAGG + Intergenic
1002649716 5:180682360-180682382 TGTCCGTGTTCTCCAGTGGGTGG + Intergenic
1003070507 6:2941936-2941958 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1003075232 6:2977901-2977923 TGTGTCTGAATTCCAAAGGGAGG + Intergenic
1004962219 6:20802788-20802810 TGACCCTGAAGGCCAGTGAGTGG + Intronic
1005784979 6:29235745-29235767 TATGCCTGAATTCCAAAGGGAGG - Intergenic
1005820685 6:29596107-29596129 TGTCCCTAAACTCCAGAGGAAGG - Intronic
1006579952 6:35071487-35071509 TGTGCCTGAATTCCACAGGGAGG + Intronic
1007099204 6:39232934-39232956 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1008649872 6:53551214-53551236 TGTGCCTGAAATCCAAAGGGAGG - Intronic
1009362767 6:62835577-62835599 TGTTCCTAATTTCCAGAGGGAGG + Intergenic
1010584661 6:77643214-77643236 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1012227209 6:96717901-96717923 TGTGCCTGAATTCCAACGGGAGG - Intergenic
1012315332 6:97778496-97778518 TGTACCTGAATTCCAAAGGGAGG - Intergenic
1013607350 6:111762463-111762485 TGTGCCTGAACTCCAAAGGGAGG - Intronic
1013701789 6:112779822-112779844 TGTCCCTGATCTCCTGTGGAGGG - Intergenic
1013888182 6:114996661-114996683 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1014924235 6:127252544-127252566 TGTCCCTGATTTCCATTGAGGGG - Intergenic
1015704154 6:136069020-136069042 TGTGCCTGAATTCCTAAGGGAGG + Intronic
1015879794 6:137860191-137860213 TGTGCCTGAATTCCAAAGAGAGG - Intergenic
1016028561 6:139313929-139313951 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1016310144 6:142725254-142725276 TCTCCCTGTGTTCCAGTGAGAGG - Intergenic
1016490742 6:144598761-144598783 TGTGCCTGAATTCCAAAGAGAGG + Intronic
1016681078 6:146830000-146830022 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1018428631 6:163705515-163705537 TAGCCCAGAATTCCTGTGGGAGG + Intergenic
1018619234 6:165714574-165714596 TGTGCCTGGATTCGAGTAGGGGG - Intronic
1018759368 6:166877911-166877933 TGTGCCTGAATTCCACTGGGAGG + Intronic
1019476827 7:1248384-1248406 GGTCCCTGGACACCAGTGGGTGG - Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1019950074 7:4364978-4365000 TATGCCTGAATTCCAGTGGGAGG - Intergenic
1020335138 7:7057241-7057263 TGTCCCTAACATCCGGTGGGGGG + Intergenic
1020756883 7:12213949-12213971 TGTGCCTGAATTCCAAAGAGAGG - Intronic
1020782101 7:12530509-12530531 TGCGCCTGAATTCCAAAGGGAGG + Intergenic
1020974536 7:14988656-14988678 TGTGCCTGAATTTCAAAGGGAGG + Intergenic
1022789031 7:33668501-33668523 TGTCCATGATTTACAGTGAGGGG + Intergenic
1023391980 7:39719649-39719671 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1024034508 7:45495802-45495824 TCTTCCTGAATTCCAGAGGGAGG + Intergenic
1024122097 7:46253771-46253793 TGTGCCTGAATTCTAAAGGGAGG - Intergenic
1024160614 7:46671249-46671271 TGTGCCTGAATTCCAAAGGGTGG - Intergenic
1024252241 7:47514939-47514961 TGTCACTGAGTTCCCTTGGGTGG - Intronic
1024305483 7:47925639-47925661 TGTGCCTCAATTCCAATGGGAGG - Intronic
1024318001 7:48039368-48039390 TGTGCCTGAATTCCAAAGGAAGG + Intronic
1024388440 7:48780127-48780149 TGTGCCTGAATTCCAAAGGAAGG + Intergenic
1024485027 7:49908224-49908246 TGTGCCTGAATTCCAAAAGGAGG + Intronic
1024581083 7:50801753-50801775 TGTCCCTGAATCCAAGGTGGAGG + Intergenic
1025005898 7:55354503-55354525 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1026247421 7:68633658-68633680 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1026350890 7:69514172-69514194 TGTCCCTGCAGTCTAGTGAGGGG - Intergenic
1027521504 7:79215139-79215161 TGTTCCTGAATTCCAAAGGGAGG - Intronic
1027620686 7:80481404-80481426 TATGCCTGAATTCCAAAGGGAGG - Intronic
1028154102 7:87409825-87409847 TGGCCCTGACTTCCAGTTTGTGG + Intronic
1028389433 7:90297245-90297267 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1028399662 7:90411088-90411110 GTTGCATGAATTCCAGTGGGAGG - Intronic
1029286413 7:99468837-99468859 CCTCCCTGGATTCCAGTGTGCGG - Intergenic
1029616238 7:101659866-101659888 TGTACCTGAATTCCAAAGGGAGG + Intergenic
1030185309 7:106755884-106755906 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1031442436 7:121811247-121811269 TCATCTTGAATTCCAGTGGGAGG - Intergenic
1032887349 7:136155020-136155042 TGTCCCTGAAGGCAAATGGGAGG - Intergenic
1033162247 7:139007946-139007968 TGTGCCTGAGTTCCAAAGGGAGG - Intergenic
1033801287 7:144905485-144905507 TGTGCATGAATTCCAAAGGGAGG + Intergenic
1034060133 7:148079806-148079828 TGTGCCTGGATTCCAAAGGGAGG + Intronic
1034109868 7:148526535-148526557 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1034509679 7:151523528-151523550 ATTCCCTGAATTTCACTGGGAGG + Intergenic
1035089446 7:156294794-156294816 TGTGGCAGAATTTCAGTGGGTGG - Intergenic
1036057918 8:5280380-5280402 TGTGCCTGAATGTCAGAGGGAGG - Intergenic
1036221446 8:6924168-6924190 TGTGCCTGAATTCCAATGGGAGG - Intergenic
1036636660 8:10555259-10555281 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1037174749 8:15933428-15933450 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1037331041 8:17743960-17743982 TGTGCCTGAATTCTAAAGGGAGG - Intronic
1037670107 8:21007619-21007641 TGTGCCTGAATTTCAAAGGGAGG - Intergenic
1038458159 8:27692081-27692103 TGTGCTTGAATTCCAAAGGGAGG - Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1040821645 8:51565163-51565185 TATACCTGACTTCCTGTGGGAGG + Intronic
1041805329 8:61843081-61843103 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1042820350 8:72923505-72923527 TGTCCCTGAATTCCAAAGGGTGG + Intronic
1042979029 8:74505172-74505194 TGTGCCTGAATTCCAAAGGGAGG - Intergenic
1044274162 8:90280802-90280824 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1044396570 8:91720403-91720425 TGTGCCTAAATTCCAAAGGGAGG + Intergenic
1045290824 8:100831256-100831278 TGTGCCTGAACTCCAAAGGGAGG + Intergenic
1045644268 8:104284916-104284938 TGTCCCTGAATTCCAAAGGGTGG + Intergenic
1045828179 8:106426055-106426077 TTTCCCTGACTTACAGTGGAGGG + Intronic
1046462643 8:114561546-114561568 TGCTGCTGAATTCCAGTGAGAGG + Intergenic
1048800575 8:138190366-138190388 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1049237032 8:141517583-141517605 TGACCCTGGAATCCAGAGGGAGG - Intronic
1049482186 8:142831119-142831141 TGTGCCTGAATTCCAAGGTGGGG - Intergenic
1049959849 9:727989-728011 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1050034519 9:1421435-1421457 TTTCCCCTAATTCCACTGGGTGG + Intergenic
1050796875 9:9557265-9557287 TGTGCCTGAATTCCAAAGGTAGG - Intronic
1050830811 9:10009918-10009940 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1050995099 9:12207437-12207459 TGTGCCTGAATTCCAACGGGAGG + Intergenic
1052132852 9:24870773-24870795 TATGCCTGAATTCCATTGTGGGG - Intergenic
1053497581 9:38559670-38559692 AGTCCCTGAATTTCAAAGGGAGG + Intronic
1053846874 9:42248638-42248660 TGTGCCTGAATTCCAAAGGAAGG - Intergenic
1056405154 9:86266832-86266854 TGTGCCTGTAATCCTGTGGGAGG - Intronic
1056453122 9:86735581-86735603 TGTGCCTGAACTCCAAAGGGTGG - Intergenic
1056715592 9:89025627-89025649 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1056955975 9:91081598-91081620 TATGCCTGAATTCCAAAGGGAGG + Intergenic
1056983983 9:91344052-91344074 TGTGCCTGAATTCCAACGGGAGG - Intronic
1057580116 9:96280117-96280139 TGTGCCTGAATTCCAAAGGGAGG + Intronic
1057943927 9:99308158-99308180 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1058449498 9:105082939-105082961 TGTACCTGAATTCCACTGGGAGG + Intergenic
1059294112 9:113254503-113254525 TGTCCCTCAAGTCCAGTCTGTGG - Intronic
1059945743 9:119406637-119406659 TGTCACTGTACTCCAGTGTGGGG - Intergenic
1061801563 9:133115834-133115856 TCACCCTGAAACCCAGTGGGTGG + Intronic
1185788668 X:2911786-2911808 TGTGCCTGAATTCCAAAGGGAGG - Intronic
1186448950 X:9656101-9656123 TTTCCCTGATTTCCAGAGTGAGG - Intronic
1186811925 X:13198676-13198698 TGTGCCTGAACTCCAAAGGGAGG - Intergenic
1187980865 X:24755913-24755935 TGTTCCTGTATTCCAGGGGTTGG + Intronic
1188508146 X:30905766-30905788 TGTGCCTCAATTCCAAAGGGAGG - Intronic
1188937806 X:36198736-36198758 TGTGCCTGAATTCCAACAGGAGG + Intergenic
1189176198 X:38959879-38959901 TGTGCCTGAATTCCAAAGGGAGG + Intergenic
1189785301 X:44554073-44554095 TGTGCCTGAATTCCAGAGGGAGG + Intergenic
1190681517 X:52830560-52830582 TGTCGCTGACTTCTAGTAGGAGG + Intergenic
1190866947 X:54392668-54392690 TGTGTCTGAATTCCAATGGGAGG - Intergenic
1194481798 X:94435922-94435944 TGTGCCTGAATTCCGAAGGGAGG + Intergenic
1195059099 X:101177004-101177026 GGTCCCTTGATTCCAGTGGCGGG + Intergenic
1195406958 X:104525029-104525051 TGTCCTTGAACTCAAGTGGAAGG - Intergenic
1196136596 X:112216534-112216556 TGTCCATGAATTCTAGTTGCAGG + Intergenic
1196257618 X:113540139-113540161 TGTACCTGAATTCCAAAAGGAGG + Intergenic
1197277858 X:124500782-124500804 TCTCCTTGAAAGCCAGTGGGTGG + Intronic
1197468184 X:126832822-126832844 TGTGCCTGAATTCTAAAGGGAGG + Intergenic
1197835604 X:130690670-130690692 TGGCCCTGAAGTCCCCTGGGTGG + Intronic
1199260422 X:145767140-145767162 TCTGCCTGAATTCCAAAGGGAGG - Intergenic
1200070692 X:153527616-153527638 TGTCCCTGGATCCCACGGGGAGG - Intronic
1200108534 X:153727161-153727183 TGTCCCCGAATTCCACGGAGAGG + Intronic
1201148285 Y:11078808-11078830 TGTGCCTGAATTACAAAGGGAGG - Intergenic
1201286261 Y:12381326-12381348 TGCACCTGAATTCCAAAGGGAGG + Intergenic
1201849318 Y:18460593-18460615 TGCCACTGCATTCCACTGGGTGG + Intergenic
1201884000 Y:18859782-18859804 TGCCACTGCATTCCACTGGGTGG - Intergenic