ID: 1014246730

View in Genome Browser
Species Human (GRCh38)
Location 6:119078286-119078308
Sequence GTTGGGAAGATGGCGACCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014246730_1014246744 11 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246744 6:119078320-119078342 GGGGCACCTGTCCCCGCGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 345
1014246730_1014246747 18 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246747 6:119078327-119078349 CTGTCCCCGCGGGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 269
1014246730_1014246745 14 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246745 6:119078323-119078345 GCACCTGTCCCCGCGGGTGGAGG 0: 1
1: 0
2: 8
3: 14
4: 147
1014246730_1014246735 -8 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246735 6:119078301-119078323 TTCCCAACAGACCCCAGCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 137
1014246730_1014246751 25 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246751 6:119078334-119078356 CGCGGGTGGAGGCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 271
1014246730_1014246741 7 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246741 6:119078316-119078338 AGCCGGGGCACCTGTCCCCGCGG 0: 1
1: 0
2: 1
3: 7
4: 144
1014246730_1014246734 -9 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246734 6:119078300-119078322 CTTCCCAACAGACCCCAGCCGGG 0: 1
1: 0
2: 5
3: 36
4: 398
1014246730_1014246742 8 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246730_1014246733 -10 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246733 6:119078299-119078321 TCTTCCCAACAGACCCCAGCCGG 0: 1
1: 0
2: 1
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014246730 Original CRISPR GTTGGGAAGATGGCGACCCC GGG (reversed) Exonic