ID: 1014246731

View in Genome Browser
Species Human (GRCh38)
Location 6:119078287-119078309
Sequence TGTTGGGAAGATGGCGACCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014246731_1014246744 10 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246744 6:119078320-119078342 GGGGCACCTGTCCCCGCGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 345
1014246731_1014246742 7 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246731_1014246734 -10 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246734 6:119078300-119078322 CTTCCCAACAGACCCCAGCCGGG 0: 1
1: 0
2: 5
3: 36
4: 398
1014246731_1014246747 17 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246747 6:119078327-119078349 CTGTCCCCGCGGGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 269
1014246731_1014246741 6 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246741 6:119078316-119078338 AGCCGGGGCACCTGTCCCCGCGG 0: 1
1: 0
2: 1
3: 7
4: 144
1014246731_1014246745 13 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246745 6:119078323-119078345 GCACCTGTCCCCGCGGGTGGAGG 0: 1
1: 0
2: 8
3: 14
4: 147
1014246731_1014246735 -9 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246735 6:119078301-119078323 TTCCCAACAGACCCCAGCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 137
1014246731_1014246751 24 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246751 6:119078334-119078356 CGCGGGTGGAGGCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014246731 Original CRISPR TGTTGGGAAGATGGCGACCC CGG (reversed) Exonic