ID: 1014246732

View in Genome Browser
Species Human (GRCh38)
Location 6:119078296-119078318
Sequence GCTGGGGTCTGTTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 600}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014246732_1014246745 4 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246745 6:119078323-119078345 GCACCTGTCCCCGCGGGTGGAGG 0: 1
1: 0
2: 8
3: 14
4: 147
1014246732_1014246747 8 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246747 6:119078327-119078349 CTGTCCCCGCGGGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 269
1014246732_1014246752 30 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246752 6:119078349-119078371 GCCCGTGGAGCAACGACGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 38
1014246732_1014246744 1 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246744 6:119078320-119078342 GGGGCACCTGTCCCCGCGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 345
1014246732_1014246751 15 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246751 6:119078334-119078356 CGCGGGTGGAGGCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 271
1014246732_1014246742 -2 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246732_1014246741 -3 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246741 6:119078316-119078338 AGCCGGGGCACCTGTCCCCGCGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014246732 Original CRISPR GCTGGGGTCTGTTGGGAAGA TGG (reversed) Exonic