ID: 1014246737

View in Genome Browser
Species Human (GRCh38)
Location 6:119078304-119078326
Sequence GTGCCCCGGCTGGGGTCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 266}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014246737_1014246752 22 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246752 6:119078349-119078371 GCCCGTGGAGCAACGACGCCCGG 0: 1
1: 0
2: 0
3: 0
4: 38
1014246737_1014246744 -7 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246744 6:119078320-119078342 GGGGCACCTGTCCCCGCGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 345
1014246737_1014246756 26 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246756 6:119078353-119078375 GTGGAGCAACGACGCCCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1014246737_1014246742 -10 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246737_1014246754 23 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246754 6:119078350-119078372 CCCGTGGAGCAACGACGCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1014246737_1014246751 7 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246751 6:119078334-119078356 CGCGGGTGGAGGCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 21
4: 271
1014246737_1014246745 -4 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246745 6:119078323-119078345 GCACCTGTCCCCGCGGGTGGAGG 0: 1
1: 0
2: 8
3: 14
4: 147
1014246737_1014246747 0 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246747 6:119078327-119078349 CTGTCCCCGCGGGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014246737 Original CRISPR GTGCCCCGGCTGGGGTCTGT TGG (reversed) Exonic