ID: 1014246742

View in Genome Browser
Species Human (GRCh38)
Location 6:119078317-119078339
Sequence GCCGGGGCACCTGTCCCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014246730_1014246742 8 Left 1014246730 6:119078286-119078308 CCCGGGGTCGCCATCTTCCCAAC 0: 1
1: 0
2: 1
3: 7
4: 184
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246732_1014246742 -2 Left 1014246732 6:119078296-119078318 CCATCTTCCCAACAGACCCCAGC 0: 1
1: 0
2: 2
3: 50
4: 600
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246736_1014246742 -9 Left 1014246736 6:119078303-119078325 CCCAACAGACCCCAGCCGGGGCA 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246731_1014246742 7 Left 1014246731 6:119078287-119078309 CCGGGGTCGCCATCTTCCCAACA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246729_1014246742 18 Left 1014246729 6:119078276-119078298 CCAGCTCATGCCCGGGGTCGCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158
1014246737_1014246742 -10 Left 1014246737 6:119078304-119078326 CCAACAGACCCCAGCCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1014246742 6:119078317-119078339 GCCGGGGCACCTGTCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014246742 Original CRISPR GCCGGGGCACCTGTCCCCGC GGG Exonic