ID: 1014248539

View in Genome Browser
Species Human (GRCh38)
Location 6:119093184-119093206
Sequence CTTTGTGGAGGGAGTACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014248530_1014248539 23 Left 1014248530 6:119093138-119093160 CCACTGCCACTAACCTTTCATAA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 181
1014248531_1014248539 17 Left 1014248531 6:119093144-119093166 CCACTAACCTTTCATAAAATGCT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 181
1014248533_1014248539 10 Left 1014248533 6:119093151-119093173 CCTTTCATAAAATGCTGGTATGT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014248539 Original CRISPR CTTTGTGGAGGGAGTACAGT AGG Intronic
902693866 1:18127279-18127301 CTATGTGAGGGGAGTACAGCAGG + Intronic
904238476 1:29128840-29128862 TTTGGTGGAGGGATAACAGTAGG + Intergenic
904290132 1:29479667-29479689 CTTATTGGAGGGAGTTCTGTGGG + Intergenic
905136380 1:35803674-35803696 CTTTTTGGAGGGGGAACAGTAGG + Intergenic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
911475518 1:98367653-98367675 CTTTGTGGAGGCAGTGGGGTTGG - Intergenic
912857085 1:113178623-113178645 CTTTGTGGAGGGAGAGATGTCGG - Intergenic
913172149 1:116242831-116242853 CTTTTTGGAGAGAGTTCAGAAGG - Intergenic
913510995 1:119562228-119562250 TTTTGTGCATGGAGTACAGAAGG - Intergenic
916032016 1:160885194-160885216 CTTTATGGAGGAAGCCCAGTGGG + Intergenic
916901826 1:169233379-169233401 CTTTGAGGCAGAAGTACAGTAGG + Intronic
917580700 1:176375069-176375091 CTATCTGGAAGGATTACAGTTGG + Intergenic
922855163 1:228768954-228768976 CTTTATGAGGGGAGTACAGTAGG - Intergenic
1063888279 10:10601871-10601893 GTTTGGGGAGGGAGAACATTAGG - Intergenic
1068238683 10:54274130-54274152 CTTTTTGGAGGGTGGAGAGTTGG + Intronic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1069636214 10:69926369-69926391 CTTTGTGGTGGGGGGAGAGTCGG + Intronic
1069831078 10:71282740-71282762 CCTTGTGCAGGGAGTCCAGATGG - Intronic
1072815577 10:98505484-98505506 ACTGGTGGAGGGAGTATAGTTGG - Intronic
1075324194 10:121517583-121517605 CTTTGTGGATGGGCTGCAGTCGG - Intronic
1075351463 10:121728613-121728635 CTTTGTGGAGGGCGGTGAGTGGG + Intergenic
1076648396 10:131970236-131970258 CTGTCTGGAGGAAGTACAGCAGG + Intronic
1076913233 10:133402738-133402760 GTTTGTTGAGGGTGTACAGCAGG - Exonic
1077109224 11:854722-854744 CCTGGTGGAGGGGGTGCAGTGGG + Intronic
1077236240 11:1483280-1483302 CGATGTGGAGGGAGGACTGTGGG + Intronic
1078965301 11:16332988-16333010 ATTTGTGGAGGGAACAGAGTAGG + Intronic
1080465825 11:32496071-32496093 CTCTGTGCAGGGAGTTTAGTGGG - Intergenic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1083033968 11:59619548-59619570 TTCTGTGGAGGGAGTTCACTGGG - Intergenic
1087647175 11:100821592-100821614 TTTTGTGGTGGGAGTAGGGTAGG - Intronic
1088395504 11:109363506-109363528 CTTTATGGAGAAAGAACAGTAGG - Intergenic
1089140732 11:116281889-116281911 CTATGTGGAGGGAGCTCACTTGG - Intergenic
1089458037 11:118636788-118636810 CTTTCTGGAGGGAATGCGGTAGG + Intronic
1094202788 12:27810347-27810369 CTTTGGTGAGGGAGTGCAGGCGG + Intergenic
1095163879 12:38948787-38948809 TTGTATGGAGGGAGTAGAGTGGG - Intergenic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1097873916 12:64625746-64625768 CTCTGTGGAGAGAGAACAGAGGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102469328 12:113150669-113150691 CTTTGAGGAGCAAGGACAGTGGG - Intronic
1103660006 12:122506636-122506658 GTGTGTGTAGGGAGGACAGTGGG + Intronic
1104047547 12:125173838-125173860 CTTAGAGGACGGAGTGCAGTGGG + Intergenic
1105808545 13:23973499-23973521 TTTTCTGGAGGGATCACAGTGGG - Intergenic
1105846072 13:24295121-24295143 CCTCGTAGAGGGAGTACCGTGGG + Intronic
1108243694 13:48493594-48493616 CGGTGTGGAGGGAGCACAGTGGG - Intronic
1110614802 13:77529644-77529666 CCTTGTGGAGAAAGGACAGTTGG + Intergenic
1110888161 13:80664863-80664885 CTTGGAGTAGGGAGGACAGTGGG + Intergenic
1111904812 13:94242633-94242655 CTGTGTTTAGGGATTACAGTGGG + Intronic
1112333934 13:98498721-98498743 TCTTGTGCAGGGTGTACAGTGGG - Intronic
1113325591 13:109278149-109278171 CTTTGGGGAAGGATTTCAGTAGG - Intergenic
1118951342 14:70439095-70439117 CCGTGTGGTGTGAGTACAGTGGG + Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120314545 14:82874675-82874697 GTTTGGGGAGGGAGTACATAAGG - Intergenic
1121573099 14:94962197-94962219 CTTTGAGGAGGGAGTGGAGCTGG + Intergenic
1122162034 14:99791938-99791960 CTTGGTGGATGGAGGACAGTGGG - Intronic
1124054152 15:26226176-26226198 CTTTGTGGAGTGAAGACACTGGG - Intergenic
1124591458 15:31057378-31057400 CCTTTTGGAGGGAGGAGAGTGGG + Intronic
1125210731 15:37212323-37212345 CTTTTTGGAGGGTGGAAAGTGGG - Intergenic
1125448860 15:39787007-39787029 GATGCTGGAGGGAGTACAGTTGG - Intergenic
1125541789 15:40473952-40473974 AGTTGTGGAAGGAATACAGTTGG + Exonic
1126141773 15:45445081-45445103 ATTTATGGAGGGAGTAGAGATGG + Intronic
1126384560 15:48080732-48080754 CTGAGTGTAGGGAGTACAGAGGG + Intergenic
1126964756 15:54039490-54039512 CTGTGTGGAGGGATTCTAGTTGG - Intronic
1127284653 15:57521853-57521875 CTTTGGGGAGGGGGTTGAGTTGG + Intronic
1127317229 15:57808490-57808512 TTTTGTGGATGGAATCCAGTTGG - Intergenic
1127951721 15:63814211-63814233 CTGTGTGGTGGGATTACAGATGG + Intronic
1128700947 15:69803859-69803881 CTTTGGGGAGGAAGTGCAGGAGG + Intergenic
1130153300 15:81328583-81328605 CTTTGTGTAAGGATTAGAGTAGG + Intergenic
1130709795 15:86268623-86268645 CTTTTTGGAGAGAGCACTGTGGG + Intronic
1130849878 15:87782546-87782568 GTTTTTAGAGGGAGTTCAGTAGG - Intergenic
1131386800 15:92014763-92014785 CTCTGTGGAGGGAGAAGGGTGGG + Intronic
1131772800 15:95758781-95758803 TTTTGTGAGGGGAATACAGTTGG - Intergenic
1132701396 16:1223639-1223661 CTTCATGGAGGAAGTGCAGTGGG - Intronic
1134165065 16:11923355-11923377 GTTTGGGGCAGGAGTACAGTTGG + Intergenic
1134304220 16:13017942-13017964 CTTTGAGAAGGGAATACAGGTGG - Intronic
1135954552 16:26945345-26945367 CTCTGTGGAAGGAGTAGAGGAGG + Intergenic
1136095342 16:27951512-27951534 CTTTGTGGAGGCAGGACCTTTGG + Intronic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1139312744 16:66041020-66041042 CTTTGTGGAAGGAGAAGAGAAGG - Intergenic
1140978742 16:80085758-80085780 GTTTGTTGAATGAGTACAGTGGG - Intergenic
1142868483 17:2805696-2805718 CTCTGTGGAGAGAGCACAGAGGG - Intronic
1146934914 17:36807506-36807528 CTTTCTTGAGGGAGACCAGTGGG - Intergenic
1147288195 17:39419957-39419979 CTTTGTGGTTGGAATACAATAGG - Intronic
1147457990 17:40550471-40550493 CTTTGTTGAGGGTGAACAGTTGG - Intergenic
1147568360 17:41551619-41551641 CTGAGAGGAGGGAGAACAGTAGG + Intergenic
1150596411 17:66609861-66609883 CTTTGTGTTGAGAGTACAGTAGG - Intronic
1153057481 18:960907-960929 CTTTGACAAGGGAATACAGTTGG + Intergenic
1167687229 19:50963902-50963924 CTTTGTGGAGGATGGACTGTGGG - Intronic
1168504675 19:56923250-56923272 GTCTGTGGTGAGAGTACAGTAGG + Intergenic
1168525149 19:57082704-57082726 CTGTGAGGAGGGAGTAGAGTGGG + Intergenic
925702899 2:6656878-6656900 CTTTGAGGAGTGAGCACAGAGGG - Intergenic
926168209 2:10534727-10534749 CTTTGTGGAGGAAGGAGAATGGG + Intergenic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
931928066 2:67096806-67096828 CTTTGTGGTGGGAATTCTGTTGG + Intergenic
931957062 2:67439345-67439367 CTTTAGGGAGGGAGGAGAGTAGG - Intergenic
932723495 2:74157730-74157752 CTGTGTGGTGAGAGTATAGTAGG + Intronic
933695975 2:85217660-85217682 ATTGGGGGAGGGAGTACAGAAGG - Intronic
939018922 2:136935782-136935804 CTCTGTGAAGGGGGGACAGTTGG + Intronic
940047487 2:149424870-149424892 CTTTGGGGAGGAAGTAAAGTGGG - Intronic
940423766 2:153508563-153508585 TGTTGTTGGGGGAGTACAGTAGG - Intergenic
941389286 2:164891454-164891476 GTTTTTTGAGGGAGTATAGTGGG + Intergenic
942417573 2:175775166-175775188 CTTTGTAGAGGGTGTAGGGTGGG - Intergenic
945188599 2:207164805-207164827 CTTTCTGGAGGGATCACACTGGG + Intronic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
1170227477 20:14007750-14007772 CTTTTTGGATGGAGTAGTGTTGG + Intronic
1171344370 20:24454693-24454715 CTTTGTAGATGGAGCACAGGTGG - Intergenic
1172142849 20:32735691-32735713 CTTTCAGGCTGGAGTACAGTGGG + Intronic
1172304001 20:33868789-33868811 CTCTCTGGAGGGAGGACCGTGGG + Intergenic
1175023922 20:55881151-55881173 TTTTGTAGTGGGAGTGCAGTGGG - Intergenic
1182831065 22:33304827-33304849 CTTTGTGGAGAGAGAAGTGTAGG - Intronic
1183348606 22:37321581-37321603 CCTTCTGGAGGGTGGACAGTGGG + Intergenic
1184236447 22:43185787-43185809 CTGCGTGGAAGGAGCACAGTGGG - Intronic
1185148116 22:49150175-49150197 CTGTGTGGAGGGAGCAGGGTGGG - Intergenic
950920169 3:16686025-16686047 ACTAGTGGAGGGAGTACATTAGG - Intergenic
952785150 3:37146462-37146484 CTGTGGAGAGGGAGCACAGTGGG - Intronic
953394820 3:42560022-42560044 CTTGTTGGAGGGAGGACAGTGGG - Intronic
954361899 3:50126574-50126596 CCTTGGGGAGGGAGGACAGATGG - Intergenic
955488495 3:59459119-59459141 CTTTTTGGAGGGTGGAGAGTGGG - Intergenic
956780100 3:72596833-72596855 CTTTGTGGACCGAGCACTGTGGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958264970 3:91427321-91427343 CTTTGTGTTAAGAGTACAGTAGG + Intergenic
960070041 3:113419196-113419218 TTTTGTGGAGGGAAGTCAGTCGG - Intronic
961692999 3:128683927-128683949 CTTTGTGCAGGGTATGCAGTAGG + Intergenic
961723647 3:128911838-128911860 CATTTTGGATGGAGTACAGTGGG - Intronic
963537841 3:146550217-146550239 CTTTGTGGAGGTAGTAAGTTAGG + Intergenic
966278511 3:178204061-178204083 CTTTGTGGAGTTTGTATAGTGGG - Intergenic
966688947 3:182724466-182724488 CTTAATGGAGGGAGTGCACTGGG + Intergenic
966861876 3:184235085-184235107 CTTTGTTGAGGGTGGGCAGTGGG - Intronic
970521042 4:16884061-16884083 CTTTGTGGAGGGTGGACTGGTGG - Intronic
971274694 4:25184632-25184654 CTTTGTAGAGGGGGTAAATTAGG + Intronic
973824309 4:54689871-54689893 GTGTGGGGAGGGAGTACAGTGGG - Intronic
974400600 4:61400727-61400749 CTGTGTGAAGGCATTACAGTGGG + Intronic
975124059 4:70761944-70761966 CAGTGTGAAGGTAGTACAGTAGG + Intronic
976111391 4:81677606-81677628 TTTTGTGGATTCAGTACAGTAGG + Intronic
976462628 4:85330324-85330346 TTTTATGGAGGGATTACATTTGG - Intergenic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
978113905 4:104996103-104996125 CTTTGGGGAGGGAGAGCATTAGG - Intergenic
981437083 4:144737169-144737191 CTTTCTGGAGTCAGTGCAGTTGG - Intronic
982452320 4:155568122-155568144 CTCTGTGAAGGGAGTTGAGTAGG - Intergenic
983415467 4:167447317-167447339 CTTTGTTGTGGGTATACAGTTGG + Intergenic
983784145 4:171710924-171710946 CTTTGTAGAGAGAGAACAATGGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
985208346 4:187565485-187565507 GTTTGTGGAGGGATTATTGTGGG - Intergenic
988008647 5:25453588-25453610 CTTGGAGAAGGGAGTAGAGTGGG + Intergenic
990048511 5:51465328-51465350 CTCTGTGGTGGAATTACAGTAGG - Intergenic
990486195 5:56261373-56261395 TTTCGTGGAGGGACTAGAGTGGG - Intergenic
994842616 5:104946093-104946115 CCTTTTGGAGGGTGGACAGTGGG - Intergenic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1006169037 6:32082443-32082465 ATTTGCTGAGGGAGTACAGAGGG + Intronic
1008990413 6:57595340-57595362 CTCTGTGTTGAGAGTACAGTAGG - Intronic
1009178988 6:60493887-60493909 CTCTGTGTTGAGAGTACAGTAGG - Intergenic
1009750977 6:67879170-67879192 TTTAGGGGAGGGAGAACAGTGGG - Intergenic
1012549884 6:100456432-100456454 CTTTGCGGCGGGATTACAGTGGG + Intronic
1013191889 6:107810567-107810589 CTATCTGGAGTGAGTACAGCAGG + Intronic
1013778708 6:113707114-113707136 CTTTCTGGAGGAAGTAAAGGTGG - Intergenic
1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG + Intronic
1014738743 6:125124257-125124279 GTCTGCGGAGGGAGCACAGTGGG + Intronic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1017494934 6:154975299-154975321 CTTTGTTGATTGACTACAGTAGG + Intronic
1018166548 6:161103437-161103459 TTTTGTGGAGGGAGGAGACTGGG + Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1021215106 7:17906511-17906533 CTTTGAGGTGGGAGTATAGTTGG - Intronic
1029955183 7:104631355-104631377 ATTTCTGGAGGGGGTAGAGTTGG - Intronic
1030048107 7:105515206-105515228 CTTTTTGGGGAGAGTACATTGGG - Intronic
1032087822 7:128892977-128892999 GTTTGCTGAGGGAGTCCAGTGGG - Exonic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1036843719 8:12147153-12147175 CTTTCAGGAGGTAGTACAGCTGG + Intergenic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1041464172 8:58142494-58142516 GTTTGTGCAGGGAGAACAGGTGG - Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1043131393 8:76466802-76466824 CTTTTTGGAGGGAGTAGAAAAGG + Intergenic
1043575771 8:81654405-81654427 CTTGGGGGAGGGAGTAAAGAGGG - Intergenic
1044166228 8:88987239-88987261 ATTTGTGGAGTGAGAACAATGGG + Intergenic
1045620749 8:103975484-103975506 CTTTGTGGAGGAGGGACACTGGG - Exonic
1046692507 8:117301705-117301727 CTGTGTGGTGGCAGTACATTAGG - Intergenic
1049398417 8:142412630-142412652 CTTCGTGGGGGCAGTGCAGTGGG - Intergenic
1049462405 8:142736191-142736213 CTTGTTGGAGGGAATAGAGTGGG + Exonic
1049809510 8:144558697-144558719 CTTTTTGCAGGGAGCAGAGTAGG - Intronic
1050664310 9:7918148-7918170 ATTTATGGAGGGAGTACTTTGGG + Intergenic
1051538251 9:18184506-18184528 CTTTTTGGAGTGAGTAAAGAAGG + Intergenic
1056383610 9:86077646-86077668 CTTTGTGGAGGGCGCTCAGGTGG - Intronic
1057413093 9:94835764-94835786 GTGAGTGGAGGGAGTGCAGTAGG + Intronic
1059735411 9:117095064-117095086 CTTTGTGGAGGTAGGAGAGAAGG + Intronic
1059872420 9:118592786-118592808 CTTTGTGGAGGTAGTTTATTTGG + Intergenic
1060112909 9:120919373-120919395 CTTTGTGGTGGGGTCACAGTGGG + Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1186230202 X:7445398-7445420 CTCTGTGGAATGACTACAGTGGG + Intergenic
1195031521 X:100931370-100931392 CCTTGTGGAAGGAGTAGTGTGGG - Intergenic
1195160642 X:102167446-102167468 CTTTGAAGAGGGAGGATAGTGGG - Intergenic
1195523509 X:105858549-105858571 CTTTGAGAAGAGAGTACAGCTGG - Intronic
1195704690 X:107730376-107730398 CTGTATGAAGGGAGTTCAGTGGG - Intronic
1196639245 X:118039239-118039261 CTATGTGGAGAGACCACAGTGGG + Intronic
1201915873 Y:19180756-19180778 GTTTGTGGAGGGAGTAATGGTGG - Intergenic
1202055655 Y:20827016-20827038 CTTTAAGAAAGGAGTACAGTTGG - Intergenic
1202095218 Y:21242745-21242767 CTTTGTGGTATGAGTGCAGTGGG + Intergenic