ID: 1014255860

View in Genome Browser
Species Human (GRCh38)
Location 6:119159629-119159651
Sequence CCCAGCATGGTGAAGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014255860_1014255876 10 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255876 6:119159662-119159684 GGTGGGGAGGGTCTGTGGGAAGG No data
1014255860_1014255866 -8 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255866 6:119159644-119159666 ATGCTGGGCCCATCCTTGGGTGG No data
1014255860_1014255868 -6 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255868 6:119159646-119159668 GCTGGGCCCATCCTTGGGTGGGG No data
1014255860_1014255867 -7 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255867 6:119159645-119159667 TGCTGGGCCCATCCTTGGGTGGG No data
1014255860_1014255874 5 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255874 6:119159657-119159679 CCTTGGGTGGGGAGGGTCTGTGG No data
1014255860_1014255875 6 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255875 6:119159658-119159680 CTTGGGTGGGGAGGGTCTGTGGG No data
1014255860_1014255870 -2 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255870 6:119159650-119159672 GGCCCATCCTTGGGTGGGGAGGG No data
1014255860_1014255877 17 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255877 6:119159669-119159691 AGGGTCTGTGGGAAGGAGAGAGG No data
1014255860_1014255869 -3 Left 1014255860 6:119159629-119159651 CCACACCACTTCACCATGCTGGG No data
Right 1014255869 6:119159649-119159671 GGGCCCATCCTTGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014255860 Original CRISPR CCCAGCATGGTGAAGTGGTG TGG (reversed) Intergenic
No off target data available for this crispr