ID: 1014257186

View in Genome Browser
Species Human (GRCh38)
Location 6:119173044-119173066
Sequence TTGCCGTTTCCAATAACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014257186_1014257188 22 Left 1014257186 6:119173044-119173066 CCTAGGGTTATTGGAAACGGCAA No data
Right 1014257188 6:119173089-119173111 GTCATAACAAAACAAGCTGGAGG No data
1014257186_1014257187 19 Left 1014257186 6:119173044-119173066 CCTAGGGTTATTGGAAACGGCAA No data
Right 1014257187 6:119173086-119173108 GTTGTCATAACAAAACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014257186 Original CRISPR TTGCCGTTTCCAATAACCCT AGG (reversed) Intergenic
No off target data available for this crispr