ID: 1014257575

View in Genome Browser
Species Human (GRCh38)
Location 6:119178292-119178314
Sequence AAACTGTCAGCAGTTTCATA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014257575_1014257578 26 Left 1014257575 6:119178292-119178314 CCATATGAAACTGCTGACAGTTT 0: 1
1: 0
2: 4
3: 27
4: 211
Right 1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG 0: 1
1: 0
2: 1
3: 9
4: 115
1014257575_1014257576 24 Left 1014257575 6:119178292-119178314 CCATATGAAACTGCTGACAGTTT 0: 1
1: 0
2: 4
3: 27
4: 211
Right 1014257576 6:119178339-119178361 ATATGTTTCAGCCTAATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 137
1014257575_1014257577 25 Left 1014257575 6:119178292-119178314 CCATATGAAACTGCTGACAGTTT 0: 1
1: 0
2: 4
3: 27
4: 211
Right 1014257577 6:119178340-119178362 TATGTTTCAGCCTAATCCATGGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014257575 Original CRISPR AAACTGTCAGCAGTTTCATA TGG (reversed) Exonic
902949563 1:19871520-19871542 CAAATATCAGCAATTTCATATGG + Intergenic
905196795 1:36286074-36286096 AAACTATCAACATTTTCTTAAGG - Intronic
908809389 1:67964298-67964320 TGACTGTCAGCAATTTCACATGG - Intergenic
909534711 1:76723692-76723714 AAACTATCCAAAGTTTCATATGG + Intergenic
909627599 1:77735165-77735187 AGATTGTCAGCAGTTTCCTATGG - Intronic
909985064 1:82151381-82151403 AATCTGTCATCAGTTTTAAAAGG - Intergenic
911355152 1:96808322-96808344 AATCTGCTAGCAGTTTCATCTGG - Intronic
912588945 1:110794576-110794598 AAAATGCCAGTAGTTTGATAGGG - Intergenic
914092984 1:144520247-144520269 GACTTGTCAGCAGTTTCAGAAGG + Intergenic
914305543 1:146413625-146413647 GACTTGTCAGCAGTTTCAGAAGG - Intergenic
914596514 1:149159181-149159203 GATTTGTCAGCAGTTTCAGAAGG + Intergenic
916766029 1:167861625-167861647 AAACTGTCATCAATGTCCTAAGG + Intronic
917233391 1:172862884-172862906 AAAATGTCAGAAGTTATATAGGG + Intergenic
917787157 1:178471011-178471033 AAACTTTCAGCTGTTTAGTAGGG + Intronic
918956002 1:191208499-191208521 CAAATATTAGCAGTTTCATATGG + Intergenic
919078664 1:192843013-192843035 AAACTTTCAGCAAATTCAAAAGG + Intergenic
919960271 1:202460388-202460410 AAGCTGTCAGCAGATTAATTTGG + Intronic
921523406 1:216186390-216186412 ATATTGTCTGCAGTGTCATATGG - Intronic
921529486 1:216263584-216263606 AAACTGTCAGCAAATTAGTATGG + Intronic
921864063 1:220070193-220070215 AAACTGGCAGCAGATTTAAAAGG + Intronic
924110485 1:240694133-240694155 AAAGTGCCAGCAGTATAATAGGG + Intergenic
924157173 1:241190751-241190773 AAACAGTCACCATTTTCAGATGG - Intronic
924637589 1:245803458-245803480 TGACTGTCAACAGTTTCATATGG + Intronic
1063786388 10:9389671-9389693 ACACTGTTAGCAGCTTCCTAGGG + Intergenic
1065643454 10:27808834-27808856 AAACAGTCAGAATTTACATATGG + Intergenic
1066130453 10:32388212-32388234 AAGCTTTCAGCTTTTTCATATGG + Intergenic
1066593616 10:37023792-37023814 AATGTGTTAGCAGTTTCATCTGG + Intergenic
1066793475 10:39092332-39092354 CAACGCTAAGCAGTTTCATAGGG - Intergenic
1071009656 10:80923295-80923317 AAACTACCAGTAGTTCCATATGG + Intergenic
1071858498 10:89649239-89649261 AAACTGCCAGGAGTTCCACAAGG + Intergenic
1071935098 10:90521068-90521090 AAATTATCAACATTTTCATATGG - Intergenic
1072169466 10:92846032-92846054 GAACTGTCAGAAGTCTCAGAGGG + Intronic
1072393886 10:95018412-95018434 AAACTATCATCAGGTTCAAAAGG - Intergenic
1074183953 10:111085491-111085513 AAGCTGTCAGCACCTTCAGAAGG + Intergenic
1074184447 10:111088473-111088495 AAGCTGTCAGCACCTTCAGAAGG - Intergenic
1075208252 10:120465624-120465646 CAAATATCAGCAATTTCATATGG - Intronic
1077896833 11:6459228-6459250 CAACTGTAAGCAGTTTGATGTGG + Intronic
1077914893 11:6604642-6604664 AAATTGTCTGGAGTTCCATATGG + Intronic
1078673169 11:13383075-13383097 AAACTGACAGCAGTATTAAATGG + Intronic
1080496191 11:32822596-32822618 CAAATATCAGCAATTTCATATGG - Intergenic
1080591614 11:33728710-33728732 AAACTGTCAGCAGAGTGAAAAGG + Intronic
1080991628 11:37544084-37544106 AAAATGTCAGCAGTATCACTTGG + Intergenic
1084009547 11:66339949-66339971 CAGCTGTCAGCAGTTTCTTACGG - Intronic
1084346646 11:68555347-68555369 TGAATATCAGCAGTTTCATATGG + Intronic
1087938101 11:104059358-104059380 TAACTGTCAGCAATTTCATTAGG + Intronic
1088073534 11:105818836-105818858 AAATTGCTAGCAGTTTGATATGG + Intronic
1089686910 11:120156732-120156754 AAACTGTTGTCAGTTTCATCTGG + Intronic
1090313121 11:125760594-125760616 AAACTGTGTGAAATTTCATATGG + Intergenic
1091960001 12:4685678-4685700 AAACTGTCAACAGTTTCTTCAGG - Intronic
1092932412 12:13328728-13328750 CAAATGTCAGCAATTTCATATGG + Intergenic
1093296074 12:17393163-17393185 CATTTCTCAGCAGTTTCATATGG - Intergenic
1093454169 12:19348353-19348375 AAACTTTTAGCAGTTTTTTAGGG + Intronic
1097123980 12:56758529-56758551 AAGCTGCCAATAGTTTCATATGG + Intronic
1097392893 12:59037414-59037436 AAACTGTGAGCACTTTCATCAGG - Intergenic
1098001141 12:65944697-65944719 CAATTATCAGCAATTTCATATGG - Intronic
1099142264 12:78993681-78993703 AAAGTATCAGCAATTTCATATGG - Intronic
1099625908 12:85073354-85073376 AAACTATCAGCATTTCCATATGG - Intronic
1101271574 12:103151532-103151554 AAAATGTCAGCAATCTCACATGG + Intergenic
1101526812 12:105538461-105538483 AAAGTGTCAGAACTCTCATAAGG + Intergenic
1106716662 13:32396382-32396404 CAAATATCAGCAATTTCATATGG - Intronic
1107850938 13:44573253-44573275 GGAATGTCAGCAGTTTCAGATGG - Exonic
1107977928 13:45707463-45707485 AAAATGTTAACAGTTTCTTATGG + Intronic
1108140606 13:47416756-47416778 AAACTGTCAGATCTTTCATGGGG + Intergenic
1109228071 13:59721290-59721312 AAACTTTCAGAAGATTGATAGGG + Intronic
1110695994 13:78490235-78490257 AAACTATCAGCAGTATGAAAAGG + Intergenic
1111635276 13:90895002-90895024 AGACTATCAGCAGTTACCTAAGG + Intergenic
1112165205 13:96910776-96910798 AAACTGTCAGCAGTTGCTGATGG - Intergenic
1115540883 14:34420054-34420076 GAACTGTCAGCTGTCTAATATGG - Intronic
1117322755 14:54639608-54639630 AATCTGTCAGCACTTTTATGTGG + Intronic
1117512046 14:56462250-56462272 CAACTGCCAGCTGTTTTATAAGG + Intergenic
1120624733 14:86810765-86810787 AAACTATCATCAGTTTGAAAAGG - Intergenic
1121712152 14:96046477-96046499 CAAATGTCAGCAATTTCACATGG - Intronic
1122407915 14:101511296-101511318 AATTTGTTAGCAGATTCATATGG + Intergenic
1126847409 15:52773714-52773736 AAAATGTAAGCATTGTCATAGGG + Intronic
1127065581 15:55234366-55234388 AAAGTCTCAGCAGTTCCACATGG - Intronic
1127203859 15:56691189-56691211 AACCTGTCAGCTTTTTAATAAGG + Intronic
1127228319 15:56959456-56959478 TAGCTGTCAGCTGTTTCATGTGG + Intronic
1127582766 15:60352678-60352700 GAACTATCTGCAGTCTCATATGG - Intronic
1129991771 15:79971472-79971494 AAACTGCCAACATTTTCACAGGG - Intergenic
1130727516 15:86455004-86455026 AAATGGTCAGCAGTGTCTTAGGG - Intronic
1132166689 15:99599527-99599549 ATTCTGACATCAGTTTCATATGG + Intronic
1132268167 15:100497483-100497505 AAACTGGAAATAGTTTCATAGGG + Intronic
1132819772 16:1858797-1858819 AAAACATCAGCAGTTTCATATGG + Intronic
1134224277 16:12379569-12379591 AAAGAGTCATCAGTTTCAAAAGG + Intronic
1135432122 16:22394043-22394065 AAACTATTTGCAATTTCATATGG - Intronic
1138666598 16:58574503-58574525 AAAGTGACAGCAGTTTAAAATGG - Intronic
1138773360 16:59691025-59691047 GAACTGTCAGCCCTTACATATGG - Intergenic
1138913299 16:61429648-61429670 AGACTGTCAGCAGTTGTATTTGG + Intergenic
1140037065 16:71379420-71379442 TAAATATCAGCAATTTCATATGG - Intronic
1140491280 16:75338043-75338065 AAAGTTGCAGCAGTTTCATTGGG - Intronic
1144142883 17:12366699-12366721 AAACTCTGAGATGTTTCATATGG + Intergenic
1148673333 17:49429531-49429553 AAACTTTCTGGAGTTTCATATGG - Intronic
1151924956 17:77188393-77188415 AAAGCCTCAGCAGTTACATACGG - Intronic
1153128034 18:1819247-1819269 TAATTGTAACCAGTTTCATAGGG + Intergenic
1153308789 18:3657198-3657220 AAAATGTCTGCAGTTTCATTCGG + Intronic
1155916973 18:31566755-31566777 ACAATGTCAGCAGTGTCACAGGG - Intergenic
1156142083 18:34125845-34125867 AAACTCTCACGAGTTTCATTTGG + Intronic
1156825583 18:41426964-41426986 AAACTGCCAACATTTCCATAAGG - Intergenic
1157396722 18:47347701-47347723 ATAGAGACAGCAGTTTCATATGG + Intergenic
1157410760 18:47461119-47461141 AAACTCACAGCAGTTTGATGGGG - Intergenic
1159519475 18:69499602-69499624 CAACTGTCATCAGTTTCTGATGG + Intronic
1160005427 18:75065363-75065385 TTAATGTCAGCATTTTCATATGG - Exonic
1160438363 18:78868425-78868447 AAACTGTCTGCAACTTCAAAGGG + Intergenic
1162288187 19:9756580-9756602 AAACTGTCAGAAATTTCTGAAGG + Intronic
1165191215 19:34065104-34065126 CAAGTATCAGCAATTTCATATGG + Intergenic
1167487304 19:49770189-49770211 AAACTGTCAGGATTTGCAAAGGG + Intronic
925528272 2:4829250-4829272 GATCTGTAAGAAGTTTCATAAGG + Intergenic
926241257 2:11088108-11088130 AAACTATCAGCATTTGCAGATGG + Intergenic
927567019 2:24122617-24122639 GAACTGTCTGCAGTGTCTTAAGG - Intronic
928214971 2:29353768-29353790 ACAATGTCACCAGTTTCATCTGG - Intronic
928497917 2:31853303-31853325 TAAATATCAGCAATTTCATACGG + Intergenic
929203457 2:39263123-39263145 AAACTGTCAGAAATGTCATTAGG + Intronic
931509009 2:62968121-62968143 TAACTGTCAGCAGTTTTTTTGGG + Intronic
932972086 2:76556198-76556220 AAACTGCCAGCAGGTTCATTTGG + Intergenic
933165358 2:79069445-79069467 AAACTGGCAGAATCTTCATAAGG + Intergenic
933305388 2:80591222-80591244 AAGGTGTCTTCAGTTTCATAGGG + Intronic
935474695 2:103504314-103504336 AAACTTTCTGAAGATTCATATGG + Intergenic
937483992 2:122294671-122294693 GAACTGTCATCAGTTTAATAAGG - Intergenic
938687853 2:133758196-133758218 AATTCGTTAGCAGTTTCATAAGG + Intergenic
939276914 2:140010621-140010643 AAAATGTCAGCAGTGTCAGATGG - Intergenic
939766771 2:146260407-146260429 ACACTGTCTGCAGTTTCAGCTGG + Intergenic
939991935 2:148884013-148884035 AAACTGGCAGCAGTTCCATGGGG - Intronic
940799577 2:158118590-158118612 AAACTTTCAGCTTTTTCTTAAGG + Intronic
942780940 2:179642042-179642064 AATCAGTCGTCAGTTTCATATGG - Intronic
942871406 2:180738760-180738782 AAACTCTCAGCATATTAATAAGG - Intergenic
944029120 2:195212197-195212219 CAAGTATCAGCAGTTTCATAAGG + Intergenic
944306159 2:198182480-198182502 AAACTGACAGCAATTTAAAAGGG - Intronic
1169776498 20:9260144-9260166 AAACACTGAGCAGTTTCAAAGGG + Intronic
1174852974 20:54014422-54014444 AAAGTGCCAGAAGTTCCATATGG - Intronic
1176211929 20:63928683-63928705 ACACTGTCCACAGTTCCATAGGG + Intronic
1179001515 21:37464745-37464767 AATCTATCAGCAGTTTCATATGG + Intronic
1184971888 22:48028378-48028400 AGAGTGTCAGCAATTTCATATGG - Intergenic
949122662 3:405553-405575 AAGCTGTCAGCACTTTCAGTAGG - Exonic
950418387 3:12882341-12882363 AAAATCTCAACAGTTTCATTTGG + Intergenic
952742012 3:36743028-36743050 GAACTACCAGCAATTTCATATGG - Intergenic
957305015 3:78446754-78446776 AAAATGTTATCATTTTCATATGG + Intergenic
958153420 3:89721406-89721428 AAACTCTTAGCAGTTTCTTATGG - Intergenic
960415446 3:117379945-117379967 CAACTGTGAGCAATTTTATATGG + Intergenic
961674721 3:128557676-128557698 AGACTGACAGCAGTTTCAGCCGG - Intergenic
962047954 3:131780887-131780909 AACCTGTCAGCAGATCCATAGGG + Intronic
964903994 3:161695349-161695371 AAACTGTGAGGGGTTTTATATGG + Intergenic
964931190 3:162025574-162025596 AAAATGTCAGTAGTTTTATCAGG + Intergenic
965267647 3:166565736-166565758 AAATTATCAGAACTTTCATAGGG + Intergenic
967167731 3:186797991-186798013 AAAATGTCAGCTGCTTCAAAGGG + Intronic
967287029 3:187881940-187881962 AAACTGTTTGCATTTTCAAAGGG - Intergenic
968501475 4:952130-952152 AAAATGTCATCCGATTCATACGG - Intronic
970384059 4:15538293-15538315 CAAATGTCAGCAATTTCATGTGG - Intronic
971910217 4:32786655-32786677 AAATTGACAGCAGTTTCTTTGGG + Intergenic
972789328 4:42355839-42355861 AAATTCTCAGCTGTTTCATGAGG + Intergenic
976378805 4:84376153-84376175 AAACCGTCACCCGTTTCATTAGG + Intergenic
976568012 4:86574793-86574815 AAACTATCAGCATTCTCAGATGG - Intronic
977520394 4:98075395-98075417 AATCTTCCAGCAGTTTCACAGGG - Intronic
978697793 4:111603671-111603693 CAATTATCAGCAATTTCATATGG + Intergenic
980568983 4:134585833-134585855 AAAATGTCATCATTTTCATGAGG + Intergenic
981019498 4:140010641-140010663 ATACTTACAACAGTTTCATAAGG + Intronic
981897933 4:149825994-149826016 AAACTGCGAGAAGTTTAATAGGG + Intergenic
982847574 4:160272846-160272868 AAACTGTCAGCAGTGTAGTGGGG - Intergenic
984048308 4:174830510-174830532 AAACTGCCAGAAGTTTCATAAGG + Intronic
986804626 5:11298106-11298128 AAATTGTCATCGTTTTCATAGGG - Intronic
987397838 5:17442525-17442547 AAAATATCAGCAATTTCATATGG + Intergenic
987508779 5:18808182-18808204 CAACTGTCAACACTTTTATATGG + Intergenic
989317499 5:40099554-40099576 AAACTGTCACTAATCTCATAAGG - Intergenic
990235491 5:53762930-53762952 AAACTATCAGCAGTGTGAAAAGG + Intergenic
990318220 5:54604189-54604211 ACACTGTCAGCTGGATCATAAGG - Intergenic
990503688 5:56423451-56423473 CAAATATCAGCAATTTCATATGG - Intergenic
990617898 5:57526164-57526186 AAACTCTCACCAGATTCAGATGG + Intergenic
992309163 5:75477156-75477178 AAACTGACAGCATTTTTATTTGG + Intronic
992917673 5:81475592-81475614 AAACTGAAAGAAGTTTGATATGG - Intronic
993135095 5:83950870-83950892 AATCTGACTGCAGTTTCTTAAGG - Intronic
993597254 5:89873192-89873214 AAATTTTCAGTACTTTCATAGGG + Intergenic
993889797 5:93459924-93459946 AATCTTGCAGCATTTTCATATGG - Intergenic
994020415 5:95017117-95017139 AATTTGTCAGCAGTTTGATAGGG + Intronic
994139846 5:96330152-96330174 CAAATATCAGCAATTTCATATGG - Intergenic
998244247 5:140483243-140483265 GTAATGTCAGCAGTTTCATTTGG + Intronic
998703873 5:144737017-144737039 AAACCAACAGCAGTTTCAAAAGG - Intergenic
1005436325 6:25815894-25815916 AAAAAGTAAGCATTTTCATATGG - Intronic
1006613055 6:35306620-35306642 CAAGTGTCAGAAATTTCATATGG - Intronic
1008163048 6:48102260-48102282 AAAGGGTCAGGAGTTTCATTTGG - Intergenic
1008697214 6:54053262-54053284 AAAATGTCAGCTATTTCACAAGG + Intronic
1008705658 6:54155629-54155651 AAAGTGTTTGCAGTTTCATCAGG + Intronic
1008744179 6:54648574-54648596 CAAATATCAGCAGTTTCATATGG - Intergenic
1008794751 6:55289411-55289433 AAACTGTCATGAATTTCATCAGG - Intergenic
1008961057 6:57266217-57266239 AAGATGACAGCAGTTTCATGTGG + Intergenic
1009447635 6:63762072-63762094 AAACTGTCAGAAATATCACAAGG - Intronic
1009826610 6:68874120-68874142 ATACTATCAACAGTGTCATACGG - Intronic
1010032112 6:71282075-71282097 AGACTGTCAGCAACTTCATTAGG - Intergenic
1010114918 6:72292882-72292904 AACCTTTCAGTTGTTTCATAGGG - Intronic
1010551571 6:77229896-77229918 AAACTTTCATCTGTTTCAAACGG + Intergenic
1013583528 6:111559130-111559152 AAACTGTCAGGAGGAACATATGG + Exonic
1014257575 6:119178292-119178314 AAACTGTCAGCAGTTTCATATGG - Exonic
1014916765 6:127160149-127160171 CAAATGTAAGCAGTTTCATATGG + Intronic
1014946429 6:127504058-127504080 AAACTGTAAACAGTTTCAGCAGG + Intronic
1015686492 6:135869032-135869054 TAAATATCAGCAATTTCATATGG + Intronic
1016460804 6:144278690-144278712 AAACTGTCAGCTGATTTCTAAGG - Intergenic
1016828532 6:148410395-148410417 AACATTTCAGCAGTTTCTTACGG - Intronic
1018374403 6:163197400-163197422 AAATAGCCACCAGTTTCATAAGG - Intronic
1020467199 7:8494098-8494120 AAGCTGTCAGCAGGCTCACAGGG + Intronic
1029680466 7:102105338-102105360 AAACTCACATCAGTTACATAGGG - Intronic
1030934197 7:115564106-115564128 AAACTGGCAGAAGATTCAGATGG - Intergenic
1031575277 7:123408710-123408732 ATCCATTCAGCAGTTTCATAAGG + Intergenic
1033515973 7:142106474-142106496 AAATTGTCAGCAGCCTCATGGGG + Exonic
1037199231 8:16230757-16230779 CAACTGTGAGTAATTTCATAAGG + Intronic
1037464743 8:19149184-19149206 AAACTGTCACCAGTGGCAAATGG + Intergenic
1041431976 8:57792548-57792570 AAATAGTGAGCAATTTCATATGG + Intergenic
1042783872 8:72524524-72524546 AATCTGTGAGCAACTTCATATGG + Intergenic
1044490511 8:92808700-92808722 AAAATATCAGCAGTTTCATATGG + Intergenic
1044740629 8:95322847-95322869 CATCTGGCTGCAGTTTCATAAGG + Intergenic
1044794549 8:95883702-95883724 AAACTTTCAGGAATTTCACAAGG - Intergenic
1045791729 8:105991700-105991722 AAACTGCCTGCAGTTTCTAAGGG - Intergenic
1045860801 8:106813103-106813125 CAACTGACAGCAATTTCAAAAGG - Intergenic
1045866492 8:106871678-106871700 AAACAGTCTGCAGTATCACACGG - Intergenic
1046173993 8:110550826-110550848 CAAATGTCATCAATTTCATATGG + Intergenic
1046528012 8:115406191-115406213 AAACTGTAAGCAGTTTCCCAGGG - Intergenic
1047368526 8:124235284-124235306 AAACTGCCATATGTTTCATATGG - Intergenic
1048217080 8:132506180-132506202 AAACTGTCAACACTGTCATGAGG + Intergenic
1051008280 9:12377031-12377053 AAACAGTCAGCAGGAACATAGGG - Intergenic
1051387444 9:16524208-16524230 ACACTGGTAGCAGTTTCAAAGGG - Intronic
1055008890 9:71541227-71541249 ATACTGTCAGCTCTTCCATAAGG + Intergenic
1057257361 9:93560825-93560847 AAAGTGTCATCAGGTGCATATGG - Intronic
1057436311 9:95044122-95044144 AAGCTGTCAACAGCTTCCTAGGG + Intronic
1058196955 9:101988822-101988844 AAACTGTCTTAAATTTCATATGG - Intergenic
1058757140 9:108093688-108093710 AAGCTGACAGCAGTTTCCTTGGG + Intergenic
1186206556 X:7206521-7206543 TAACTATCAGCAATGTCATATGG - Intergenic
1186875706 X:13815789-13815811 TGACTATCAGCAATTTCATATGG + Intronic
1187198026 X:17106785-17106807 AAACTGTTTTCAATTTCATATGG + Intronic
1187438447 X:19294436-19294458 AATCTGTCAACAGTTTCCCATGG + Intergenic
1187947161 X:24437420-24437442 CAAATATCAGCAATTTCATATGG + Intergenic
1188574431 X:31629767-31629789 CAATTGTCAGCAGTTACACATGG - Intronic
1189639964 X:43057957-43057979 GAAATATCAGCAGTTTCATGTGG + Intergenic
1190395217 X:49975486-49975508 AAACTGCCAGCTGTTCCATGTGG - Intronic
1192269579 X:69566162-69566184 GAACTGACAGAAGTTTAATATGG + Intergenic
1193954947 X:87848355-87848377 GAACTGTCAGCAGTTTCATGAGG - Intergenic
1194439878 X:93919114-93919136 ACACTGTCAACAGTTTAAAAAGG + Intergenic
1195120063 X:101740436-101740458 TAAATGTCAGCAATTTCATTTGG + Intergenic
1196153621 X:112403172-112403194 AAACTGTGAGCATTTTCTTTTGG - Intergenic
1196391111 X:115208432-115208454 AGACTGCCAGCAGTTTTACAAGG - Intronic
1197540144 X:127748663-127748685 AAACTGTCACAAGTGGCATATGG + Intergenic
1197630048 X:128847997-128848019 AAAATGACAGGAGTTTGATAAGG - Intergenic
1197679483 X:129366976-129366998 AAAAAGTCAGCAATTTAATATGG + Intergenic
1199118496 X:144021615-144021637 AAACTCACAGTAGTTTCATATGG + Intergenic
1200464598 Y:3499618-3499640 AACCTGCCTGCAGTGTCATATGG + Intergenic
1201309901 Y:12587521-12587543 AAATTGTCAGCAGTGTGAGAGGG - Intergenic
1202575442 Y:26319558-26319580 AAGCTGTCAGCAGATTAATTTGG - Intergenic