ID: 1014257578

View in Genome Browser
Species Human (GRCh38)
Location 6:119178341-119178363
Sequence ATGTTTCAGCCTAATCCATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014257575_1014257578 26 Left 1014257575 6:119178292-119178314 CCATATGAAACTGCTGACAGTTT 0: 1
1: 0
2: 4
3: 27
4: 211
Right 1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG 0: 1
1: 0
2: 1
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014257578 Original CRISPR ATGTTTCAGCCTAATCCATG GGG Exonic
901553560 1:10014122-10014144 AACTTTCAGCCTCATCCCTGAGG + Intronic
909817993 1:80020908-80020930 TTGTTTCAGCTTTATCCATTGGG + Intergenic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
915895941 1:159810905-159810927 ATGTGCCAGTCTAATACATGAGG - Intronic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919579975 1:199359232-199359254 ATATTGCTGCCTATTCCATGTGG + Intergenic
921301759 1:213757802-213757824 TTGTTTCAGGCTAATGCATCTGG + Intergenic
922147020 1:222956577-222956599 ATGTTTCTCCCTAATGCATAGGG + Intronic
923810103 1:237305321-237305343 ATTTTTGAGATTAATCCATGTGG - Intronic
1064168117 10:13003891-13003913 ATGTGTCTGCTGAATCCATGAGG - Intronic
1064614713 10:17141075-17141097 ATGTCTCATCCAAAACCATGAGG - Intergenic
1070265055 10:74894040-74894062 AAGTTTCAGGCTAATTCATAAGG - Intronic
1071237099 10:83661768-83661790 AGGCTTCAGGCTAAGCCATGTGG - Intergenic
1071981874 10:91011541-91011563 ATGTTTCAACCTAATATTTGGGG - Intergenic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1075772375 10:124950550-124950572 ATGTTTGAGGCAAATCCATTTGG + Intronic
1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG + Intergenic
1083132754 11:60641191-60641213 ATGGTTCAACCTAATACAAGGGG - Intergenic
1084072159 11:66743804-66743826 ATCTCCCAGCCTAATCCAGGGGG - Intergenic
1085922807 11:80979174-80979196 ATGTTTCAGCCAAATATCTGTGG - Intergenic
1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG + Exonic
1086472940 11:87135605-87135627 ATGTTTAAACCCAAACCATGCGG + Intronic
1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG + Intronic
1088100372 11:106147796-106147818 ATGTTTCAGCTTAAGCAATCAGG - Intergenic
1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG + Exonic
1094058534 12:26289724-26289746 AGGTTTCATTCTAAACCATGGGG + Intronic
1095870686 12:47024300-47024322 ATGGTTCAACCTAATACATGAGG - Intergenic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1102901717 12:116643904-116643926 ATTTTTCAGCCTACTGCAAGAGG - Intergenic
1106355711 13:28981244-28981266 TTGTTTGAGATTAATCCATGTGG - Intronic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1110076056 13:71244710-71244732 AGGTTTCAGTCAAATCCAAGTGG + Intergenic
1111657367 13:91170607-91170629 ATGTTTCAGCCTAGTAGAGGTGG + Intergenic
1116941277 14:50793314-50793336 GTGTTTCAGACTAATTGATGTGG - Intronic
1131576804 15:93600537-93600559 ATGTTTAAACCTAAGCCATATGG + Intergenic
1132220718 15:100103101-100103123 ATGTTCCTGCCTCTTCCATGCGG - Intronic
1133198461 16:4187453-4187475 ATGTATCATCTGAATCCATGGGG - Intergenic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG + Intergenic
1150362123 17:64545235-64545257 ATGTTTCAACCTAGTCTAAGTGG - Intronic
1151917648 17:77130255-77130277 ATGCTTCAGCTCAGTCCATGTGG + Intronic
1155671566 18:28378024-28378046 AGGCTTCAGCCTATTCCATGGGG - Intergenic
1159413027 18:68105841-68105863 ATGTTTCAGACTATCACATGGGG + Intergenic
1159477566 18:68942867-68942889 ATGTTTCAGACTATCACATGGGG + Intronic
1160303237 18:77705476-77705498 AAGTTTCACCCTCACCCATGTGG + Intergenic
1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG + Intronic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1163628178 19:18402815-18402837 ATGTTTCAGACTATCCCATGGGG - Intergenic
926572333 2:14543491-14543513 ATTTTTCAGCCTTGTCCAGGAGG - Intergenic
928058861 2:28088771-28088793 ATGTTTATTCCTAATCCATTTGG + Intronic
932729519 2:74208673-74208695 ATGTTACCGGCTACTCCATGGGG + Exonic
933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG + Intergenic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
935322565 2:101903064-101903086 TTGTTTCAAACTAAGCCATGAGG - Intergenic
936166902 2:110128698-110128720 ATGGTTTAGCCTAATACATCAGG - Intronic
939363629 2:141205434-141205456 ATGTTCCACCCCATTCCATGTGG - Intronic
939475822 2:142685552-142685574 ATGTTTCAGAATCATCCTTGAGG - Intergenic
939539307 2:143474061-143474083 GTGTTTCAGCCTAAGCTAGGAGG - Intronic
941428321 2:165379275-165379297 ATTTTTAAGGCTCATCCATGTGG - Intronic
944042572 2:195372980-195373002 AACTTTCCACCTAATCCATGAGG - Intergenic
945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG + Intergenic
945650380 2:212551259-212551281 ATGTTTCATCCTAATGAAAGAGG + Intergenic
946818787 2:223609147-223609169 ATATTTCAGCCCAATACAAGGGG - Intergenic
946864253 2:224028497-224028519 ATGATTGAGGCTAAGCCATGTGG - Intronic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1177378139 21:20300374-20300396 ATGTCTGAGCAAAATCCATGGGG + Intergenic
951036856 3:17942101-17942123 ATGTTTCAGCACAATTTATGAGG + Intronic
956573518 3:70724846-70724868 TTGTTTCACTCTAATGCATGTGG + Intergenic
958268671 3:91470936-91470958 ATATATCAGCATAATCCATAAGG + Intergenic
964418391 3:156473991-156474013 ATGTTTCAGCCCTAACCATTTGG - Intronic
967350354 3:188507759-188507781 AGGTTTCAGCCTTTTCCAGGGGG - Intronic
967355814 3:188569713-188569735 ATGTTTCAGCCTCGGCCATCTGG + Intronic
973026236 4:45275656-45275678 ATTATTCAGCCTACACCATGTGG + Intergenic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
974696853 4:65387429-65387451 ATCTTTCTGCCTAAGCCTTGGGG - Intronic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
976522063 4:86039808-86039830 AGGTTTCAGGCCTATCCATGGGG + Intronic
977597550 4:98900229-98900251 ATTGTTCAACCTAATACATGTGG + Intronic
978496175 4:109361427-109361449 ATGCTTCATCCTTCTCCATGTGG + Intergenic
985378567 4:189368283-189368305 ATGTTACAGGCTAACCCAAGTGG - Intergenic
987185052 5:15408920-15408942 ATGTTTCTGCAATATCCATGTGG - Intergenic
987451565 5:18090522-18090544 ATGTTCGAACCTAATACATGAGG - Intergenic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
999910861 5:156197315-156197337 GTGTTTCAAACTAATCCGTGAGG - Intronic
1000258558 5:159564024-159564046 ATGTTTCAACTTAATAAATGAGG - Intergenic
1003066582 6:2909011-2909033 ATATTTCAGACTATCCCATGGGG - Intergenic
1004308901 6:14526373-14526395 AGGTTTTGGCCTAAACCATGGGG - Intergenic
1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG + Intergenic
1008986537 6:57550651-57550673 ATATATCAGCATAATCCATAAGG - Intronic
1009174502 6:60443220-60443242 ATATATCAGCATAATCCATAAGG - Intergenic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG + Intronic
1011934193 6:92754390-92754412 CTGTTACAGCCTTCTCCATGGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015047349 6:128791856-128791878 ATATTTCCTCCTTATCCATGAGG + Intergenic
1020360889 7:7325406-7325428 TTGTTTTAACCTTATCCATGTGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023759234 7:43448203-43448225 TTGTTGCAGCCTTATCTATGTGG - Intronic
1025761651 7:64401447-64401469 ATGTGACAGACTAATACATGTGG - Intergenic
1029534775 7:101150451-101150473 ATATTTCAGACTATCCCATGGGG + Intergenic
1030177345 7:106668427-106668449 ATGTTATAGCCTAATCCTTTTGG - Intergenic
1031134150 7:117867649-117867671 ATGTTTCAGCCCACTCTAGGGGG + Intronic
1031230628 7:119100840-119100862 ATATTTCAGCCTATCACATGGGG + Intergenic
1032761069 7:134942329-134942351 ATATTTCAGTCTCATCCAAGAGG + Intronic
1033212116 7:139467752-139467774 ATATTTCAGACTATCCCATGGGG - Intronic
1033349885 7:140553575-140553597 ATATTTCAGACTATCCCATGAGG + Intronic
1035138353 7:156730502-156730524 ACGTATCAGTCTAATCCATTAGG - Intronic
1035527285 8:323813-323835 TCCTTTCAGCCCAATCCATGGGG - Intergenic
1037056969 8:14454879-14454901 ATGTATATGCCTAATCCATTTGG - Intronic
1037178402 8:15974063-15974085 AGGTTTCAGCCAAACCCATGGGG + Intergenic
1044288005 8:90431944-90431966 ATCTTTCAAAGTAATCCATGAGG - Intergenic
1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG + Intergenic
1050866701 9:10509408-10509430 TTGTTTCAGCTTCATCCATTAGG + Intronic
1051350454 9:16193610-16193632 ATCTTTCAGGCTAAAACATGGGG + Intergenic
1055166751 9:73205332-73205354 ATGTATCAGCCTATGACATGTGG - Intergenic
1056678177 9:88694663-88694685 AAGATTCAGCCTATTCCCTGGGG + Intergenic
1059021052 9:110577489-110577511 ATGTAGCAGCTTAATCCATCTGG - Intronic
1203456765 Un_GL000219v1:175558-175580 ATATTTCAGACTATCCCATGGGG - Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1192764224 X:74125926-74125948 TTGTATCTCCCTAATCCATGTGG - Intergenic
1199132861 X:144213911-144213933 ATGTTTCAGCTTAATCAATCTGG - Intergenic
1201536486 Y:15053775-15053797 TTGTTTTAACCTAAGCCATGCGG + Intergenic