ID: 1014258281

View in Genome Browser
Species Human (GRCh38)
Location 6:119186203-119186225
Sequence CCCAAGGACTTTCCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014258281_1014258289 15 Left 1014258281 6:119186203-119186225 CCCTTTGCTGGAAAGTCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1014258289 6:119186241-119186263 TATCTTGCAAAGATATGGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 152
1014258281_1014258287 13 Left 1014258281 6:119186203-119186225 CCCTTTGCTGGAAAGTCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1014258287 6:119186239-119186261 GCTATCTTGCAAAGATATGGAGG No data
1014258281_1014258288 14 Left 1014258281 6:119186203-119186225 CCCTTTGCTGGAAAGTCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1014258288 6:119186240-119186262 CTATCTTGCAAAGATATGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 162
1014258281_1014258286 10 Left 1014258281 6:119186203-119186225 CCCTTTGCTGGAAAGTCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1014258286 6:119186236-119186258 ACAGCTATCTTGCAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014258281 Original CRISPR CCCAAGGACTTTCCAGCAAA GGG (reversed) Intronic
901171636 1:7262673-7262695 TCCTAGGAGTTTCCTGCAAAGGG - Intronic
901930517 1:12594046-12594068 ACCCAGCACTTTCCAGCAAGAGG - Intronic
903754003 1:25647964-25647986 CTCCAGGTCTTTCCAGCAAGGGG - Intronic
904976907 1:34463601-34463623 CCAAAGAACTTTCCAGGAAATGG + Intergenic
907576600 1:55531820-55531842 ACTAAGGATTTTTCAGCAAAGGG + Intergenic
914437977 1:147677315-147677337 CACAAAGACTTTCCAACACATGG + Intergenic
917801201 1:178572283-178572305 CCCAAGGACATCCAAGCAATAGG + Intergenic
918128179 1:181602766-181602788 ACTAAGGACATCCCAGCAAATGG - Intronic
921158758 1:212458232-212458254 CCCAAGGACGAGGCAGCAAAGGG - Intergenic
921857600 1:220003847-220003869 CACAAGGCCATTCCAGGAAAAGG + Intronic
923146297 1:231200831-231200853 AAGCAGGACTTTCCAGCAAAAGG + Intronic
923228103 1:231958060-231958082 GCCAAGGGGTTTCTAGCAAATGG - Intronic
923585063 1:235261881-235261903 TCCCAGGACGTTCCACCAAAAGG + Intronic
1063211542 10:3885525-3885547 CTCAAGGACCTTCCAGGGAATGG - Intergenic
1070435754 10:76390999-76391021 CCCAAGAACTTACCATCCAATGG + Intronic
1071558035 10:86621211-86621233 CACAAAGACATTCCATCAAAAGG - Intergenic
1076156516 10:128209931-128209953 CCCCAGGACCTTCCCTCAAAGGG + Intergenic
1077559106 11:3246132-3246154 ACCAAGGACCATCAAGCAAATGG + Intergenic
1080333226 11:31166404-31166426 CCATAGGACTTTACAGCAGAGGG + Intronic
1081584881 11:44377329-44377351 CTCAAGAACTTTCCTGCACATGG + Intergenic
1083900637 11:65641692-65641714 GCCAGGGACTTTACAGGAAATGG - Intronic
1084432763 11:69120694-69120716 CCCAAGAGCTCTGCAGCAAAGGG - Intergenic
1086670826 11:89545170-89545192 CCAAATGATTTTTCAGCAAAAGG + Intergenic
1087262228 11:96023693-96023715 CACAAGGCCTTTCCACCTAATGG + Intronic
1088507090 11:110537559-110537581 ACCAGGGACTTTCTAACAAATGG - Intergenic
1089399393 11:118155801-118155823 CCCAAGGGACTTCCAGCAGAAGG - Intergenic
1090971708 11:131649420-131649442 CCCAAGGCCTTTCCATCACCTGG + Intronic
1091154009 11:133356885-133356907 TCCAAGGACTTTTCTGCAGAAGG + Intronic
1093727472 12:22531637-22531659 CCCAAAGGTTTTCAAGCAAATGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098611624 12:72466003-72466025 AACAAGGACTCTTCAGCAAATGG - Intronic
1102254694 12:111408726-111408748 CCAAAGGTGTTTCCAGCAAAAGG - Intronic
1103163026 12:118746067-118746089 TCCAAAGACTTTTCAGAAAATGG + Intergenic
1103523034 12:121549044-121549066 CCCAAGGACTCTCCGGGGAAAGG - Intronic
1105795544 13:23848714-23848736 CCCAAGGGGATTCAAGCAAATGG + Intronic
1106245024 13:27941753-27941775 CTCAAGGCATTTCAAGCAAAAGG + Intergenic
1107816569 13:44249960-44249982 CCCAAGGACCTCCCAGGACAAGG - Intergenic
1108683787 13:52801965-52801987 CCTATGGACTTTCCAGCAATAGG - Intergenic
1112479312 13:99759066-99759088 CCTTAGTGCTTTCCAGCAAATGG - Intronic
1112813346 13:103244801-103244823 ACCAATGACTTTGCAGAAAATGG - Intergenic
1117575516 14:57093271-57093293 CACAAGGAGGATCCAGCAAAGGG + Intergenic
1119958831 14:78831640-78831662 CCACAGGACTTTTCAGGAAATGG - Intronic
1120267113 14:82265103-82265125 TACAAGTACTTGCCAGCAAATGG - Intergenic
1123798367 15:23796829-23796851 CCAAAGGACTTTTCACCAGATGG - Intergenic
1124610126 15:31202420-31202442 CCCAAGCACTTTACAGTATATGG - Intergenic
1124938809 15:34199062-34199084 CTCATGTACTGTCCAGCAAAAGG + Intronic
1126905546 15:53360817-53360839 CCCCAGGTCTCTCAAGCAAAGGG - Intergenic
1129825469 15:78632009-78632031 CCCAGGGGGTTTCCAGGAAAAGG - Intronic
1130355509 15:83126256-83126278 CAAAAAGACTTTCCAGCAAGAGG + Intronic
1131360913 15:91789618-91789640 ACCAAGGACTTACAAGGAAAAGG - Intergenic
1131880704 15:96859156-96859178 CCCTAGGAATTTGCAGCAGAAGG + Intergenic
1133367945 16:5225906-5225928 CCCAAGGATTCCCCAGCAAAGGG - Intergenic
1134182929 16:12062040-12062062 CCCAAGCACTTTTCTGCACAGGG - Intronic
1135186819 16:20322709-20322731 CCCACTGGCTTTACAGCAAATGG + Intronic
1136953214 16:34747828-34747850 CCCATGGAATTATCAGCAAATGG - Intergenic
1138535912 16:57660292-57660314 CCAAAGGAATTTCATGCAAATGG - Intronic
1139436153 16:66937785-66937807 CCCTAGGACCTTCAAACAAAGGG - Intronic
1141299694 16:82802515-82802537 CCCTAAGACTTAGCAGCAAAAGG + Intronic
1144417981 17:15069764-15069786 TCCAAGGACTTTCATGCAGAAGG - Intergenic
1144779102 17:17799030-17799052 CCCATGGACTGTCCTGCAGAGGG - Intronic
1144872098 17:18377928-18377950 CCCAAGGACTCCCCAGCCAAGGG + Exonic
1144942332 17:18950355-18950377 CCCAAGGACTTTTGATCCAAAGG + Intronic
1151102060 17:71567116-71567138 CCCTATGACTTTCCTGTAAAGGG + Intergenic
1151307357 17:73271835-73271857 CCCCAGGACTTTGCAGCCAGAGG - Intergenic
1157369302 18:47095653-47095675 CCCAAGGATGTTCCAACAGAAGG - Intronic
1157532792 18:48436111-48436133 CTCAAGGAGCTTCCAGGAAAGGG - Intergenic
1158300455 18:56046558-56046580 CACAAGGACTTTCCAGCCTCTGG - Intergenic
1158303448 18:56078313-56078335 GCCATAGACTTTCCAGCAATGGG - Intergenic
1159189844 18:65027379-65027401 CCCAAGGCCATTCCAGGCAATGG + Intergenic
1160318452 18:77868954-77868976 GCTAAGGGCCTTCCAGCAAAGGG + Intergenic
1160447621 18:78939813-78939835 CCCAAAAACTCTCCAGCAGAAGG + Intergenic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1162438464 19:10678129-10678151 CCCAAGGCATCTGCAGCAAAGGG - Intronic
1166091468 19:40512281-40512303 CCCAAACACTGCCCAGCAAAGGG - Intronic
1166830760 19:45638478-45638500 ACCAAGGAGATTCCAGCAAAAGG + Intronic
1166889835 19:45984162-45984184 GCCCAGGACCTTCCAGCATAAGG - Intergenic
1168311309 19:55462167-55462189 CCCAAGCACTTTCCAGGAAGGGG + Intronic
926259365 2:11243054-11243076 CCAAAGGACATCCAAGCAAAGGG + Intronic
926479394 2:13371446-13371468 CCAAAGCAATTTCAAGCAAAGGG + Intergenic
928456826 2:31429993-31430015 AACTAGGACTTTCCAGAAAACGG + Intergenic
935147161 2:100403698-100403720 TCCACGCACTTTCCAGGAAATGG + Intronic
935528517 2:104203095-104203117 CCCAAGACCTTTGCATCAAAGGG + Intergenic
936931187 2:117790452-117790474 ACAAAGAACTTTCCAGAAAAAGG - Intergenic
937040962 2:118820325-118820347 CCCCAGGAGTCACCAGCAAAGGG - Intergenic
940162549 2:150729108-150729130 CCCAAAGACTTCCCAGAATATGG - Intergenic
945272458 2:207955372-207955394 CCCAAAGTCTTTCAAGAAAATGG + Intronic
1170734445 20:19002057-19002079 CCCAAGGACTTTGAACAAAAGGG - Intergenic
1174644007 20:52070269-52070291 CCCAAGTACTTTCCAGAGAGTGG + Intronic
1178821246 21:35977123-35977145 CCCCAGGAGTTTCCACCAAGAGG + Intronic
1179935279 21:44600066-44600088 CCCAAGGGCTTTAGAGCAAGTGG - Intronic
1181407002 22:22692207-22692229 CCAGAGAACTTTCCAGTAAATGG + Intergenic
1181486484 22:23234834-23234856 CCCGAAGACTGTCCAGCACACGG - Intronic
1183017285 22:34999535-34999557 CCCATGGACTATCCAGCAGGAGG + Intergenic
949613373 3:5727426-5727448 CCAAATGACTTTGCAGCACAAGG + Intergenic
950350708 3:12348728-12348750 ACCAAGGACTATCCTGCAAGGGG + Intronic
952219231 3:31307644-31307666 CTCAAGAACTTTCCAGGACAGGG - Intergenic
952929467 3:38347876-38347898 CCCAAGTACTTTAAAGGAAAAGG - Intronic
953410895 3:42690018-42690040 CCCAATGATTATCCAGTAAATGG - Intronic
954105322 3:48406728-48406750 CCCAAGGGCTTCCCTGCAAAGGG + Intronic
954320915 3:49831483-49831505 CCCAAGGCCTTACCACCCAAGGG - Intronic
955670254 3:61394477-61394499 CCCCAGGACTTTGCAGCCAGAGG + Intergenic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
957422930 3:79995078-79995100 CTCAATGATTTTCAAGCAAAGGG + Intergenic
962790098 3:138803599-138803621 TCCCAGGACTTTTCTGCAAAAGG - Intronic
966721675 3:183069214-183069236 CCCAGGGGCTTTCCAGCTATTGG + Intronic
967289540 3:187905548-187905570 CAGAAGTACTTTCCAGAAAAAGG - Intergenic
970151724 4:13097123-13097145 CTTAAGGACTTTCCATCTAATGG - Intergenic
970545360 4:17124001-17124023 CCCAGGGTCTTTCCAGCATGCGG + Intergenic
970622706 4:17841110-17841132 CCCAAGGGCTATCCAACAATAGG + Intronic
974565328 4:63573540-63573562 CCCATGGACATTCCAGAATAAGG + Intergenic
975007508 4:69309134-69309156 ACCAAGGACTATCAACCAAAGGG - Intronic
975010497 4:69344622-69344644 ACCAAGGACTATCAACCAAAGGG + Intronic
975697778 4:77030717-77030739 CCAAAGAACTTTACATCAAAAGG + Intronic
977571603 4:98634868-98634890 CCAAAGGACTTTCCAAAGAATGG - Intronic
981721066 4:147801896-147801918 CCCAGGGATTTTACAGAAAATGG + Intronic
982132304 4:152240797-152240819 CCTAAGGACTTTACTACAAAAGG + Intergenic
984366375 4:178804634-178804656 CTCCAGGTCTTTCCAGAAAAAGG - Intergenic
986211669 5:5679315-5679337 CCCAAGGCCTCTCCAGCCATGGG - Intergenic
986512510 5:8523319-8523341 ACCATGGACTGTCAAGCAAAAGG + Intergenic
986767595 5:10941637-10941659 CCCAAGGCCATTCCAGGCAAGGG + Intergenic
986812400 5:11373934-11373956 CCCAGGGACTTCCCAGCAGGAGG - Intronic
987103494 5:14613852-14613874 TCCCAGGACTTTTCTGCAAATGG + Intronic
988016639 5:25567855-25567877 ACCAAGGACTGTCAACCAAAGGG - Intergenic
988312136 5:29573532-29573554 CTCAAGGACTTACTAGCACATGG + Intergenic
988688272 5:33547201-33547223 CCTAAGTAATTTCCAGGAAAAGG + Intronic
989525778 5:42452834-42452856 CTCAAGGAGTTACCAGAAAAAGG - Intronic
993424266 5:87742940-87742962 GTCAAGGACTTTTCACCAAAGGG - Intergenic
998924942 5:147112881-147112903 CCCATGGATTTGCCAGCAAGTGG - Intergenic
1000944068 5:167398980-167399002 CCCAAGGACCTGACAGCCAAGGG - Intronic
1001746663 5:174097993-174098015 CCCGAGGCCTTCCCAGCAGAAGG + Intronic
1002952014 6:1823481-1823503 CCCAGGGTCTTTCCACCAGAAGG - Intronic
1003630211 6:7779866-7779888 CCCAAGGAGGTACCAGGAAAAGG - Intronic
1004376776 6:15097312-15097334 CCCAGGGACTTTCCAGGGAGGGG + Intergenic
1004905829 6:20236102-20236124 CCCAAGGCCTTTCCAGCCCTGGG + Intergenic
1007949018 6:45853080-45853102 CCCAAGGCCCTCCCAGCAAGGGG + Intergenic
1012661324 6:101897902-101897924 CCCAAATAATTTACAGCAAAAGG - Intronic
1014005429 6:116412453-116412475 CCCAGGCACTTCCCAGCAGAGGG - Intronic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1015739927 6:136442838-136442860 TCCAAGGGCTTTCCACAAAAGGG + Intronic
1018160114 6:161032083-161032105 CTCCAGGACTGTCCAGCATAGGG - Intronic
1021025985 7:15667353-15667375 TCCAGGGAGTTTCCAGGAAAAGG - Intronic
1022925361 7:35051203-35051225 CCCAAGGTCTGTACAGTAAAAGG + Intergenic
1023083491 7:36547186-36547208 ACCGGGGACTTTCCAGTAAATGG - Intronic
1023973046 7:45005883-45005905 CCCAAGGACTTCCCAGGACTGGG - Intronic
1024507081 7:50170776-50170798 CCCAAGGACTTTTGATCATATGG + Intergenic
1025095352 7:56091929-56091951 ACTTAGGACTTACCAGCAAATGG - Intronic
1037506163 8:19531870-19531892 CTCAATGTCTTTCCAGCAGATGG + Intronic
1039081484 8:33738274-33738296 CTCCAGGAGTTTCCAGCACATGG + Intergenic
1042424992 8:68637274-68637296 CCAAAGCAGTTTCCAGCAATAGG - Intronic
1045865964 8:106865899-106865921 CCCAAGGTCCTCCCAGCAAGTGG - Intergenic
1047511961 8:125522218-125522240 GCCAAGGGCTGTCCAGGAAAAGG + Intergenic
1055767192 9:79676202-79676224 CCCAAGGCCTTTCTGGCAAAGGG + Intronic
1057863134 9:98657915-98657937 CCCGAGGCCTTCCCAGCAATGGG + Intronic
1060810529 9:126609482-126609504 ACCCATGACTTTCCAGCACAAGG - Intergenic
1061294913 9:129671842-129671864 CCCAAGGACTGTGCAGGAGAGGG - Intronic
1061781647 9:132999775-132999797 CCCCAGGACCTTCCAGGAAAGGG - Intergenic
1187691242 X:21869492-21869514 CCCAAGGACTCTCCTGCCATTGG + Exonic
1190384930 X:49875868-49875890 CCCAAGGATTTTACATCACAGGG - Intergenic
1197162620 X:123340957-123340979 CTCAAGCTCTTTTCAGCAAAGGG + Intronic
1197826549 X:130596340-130596362 CCCAAGGCCTTTGTAGCAAGGGG + Intergenic
1198759979 X:140021940-140021962 CCCAATGAGTGTCCACCAAAAGG + Intergenic