ID: 1014268207

View in Genome Browser
Species Human (GRCh38)
Location 6:119306187-119306209
Sequence AAAATTTGTCTGTAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014268207_1014268212 18 Left 1014268207 6:119306187-119306209 CCTGTTACTTACAGACAAATTTT 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1014268212 6:119306228-119306250 AAGTGCAGTAGGAGGATACTGGG 0: 1
1: 0
2: 0
3: 8
4: 129
1014268207_1014268211 17 Left 1014268207 6:119306187-119306209 CCTGTTACTTACAGACAAATTTT 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1014268211 6:119306227-119306249 CAAGTGCAGTAGGAGGATACTGG 0: 1
1: 0
2: 0
3: 15
4: 156
1014268207_1014268210 10 Left 1014268207 6:119306187-119306209 CCTGTTACTTACAGACAAATTTT 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1014268210 6:119306220-119306242 AAGAAATCAAGTGCAGTAGGAGG No data
1014268207_1014268209 7 Left 1014268207 6:119306187-119306209 CCTGTTACTTACAGACAAATTTT 0: 1
1: 0
2: 2
3: 24
4: 328
Right 1014268209 6:119306217-119306239 AGAAAGAAATCAAGTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014268207 Original CRISPR AAAATTTGTCTGTAAGTAAC AGG (reversed) Intronic
903304532 1:22403281-22403303 AAAATTTGTTTTTAATTAGCTGG - Intergenic
904077064 1:27851263-27851285 AAGATTTGTTTGGAAGTAACTGG + Exonic
905030632 1:34881653-34881675 TAAATTTGGCTGTGAGTCACAGG - Intronic
907372011 1:54009892-54009914 CCAATTTGTATGTAAGTAAATGG - Intronic
908831121 1:68179547-68179569 AACATTTGTTTGCAAGTAACAGG + Intronic
908959889 1:69684141-69684163 AATATCTGTCTGTATGTATCTGG - Intronic
909879204 1:80851322-80851344 AAATTTTAACTGTAAATAACTGG - Intergenic
909967246 1:81930011-81930033 AAAATTGGTGTGTAAGTTCCAGG - Intronic
911743647 1:101415409-101415431 ATCAATTGTCTGTAAGTATCTGG - Intergenic
913212190 1:116590818-116590840 AACATTTGTCTGTGTGTTACAGG - Intronic
913346146 1:117813050-117813072 AAACTTTTTCTGTAAATAGCTGG + Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915672365 1:157500555-157500577 AAAATTTGTTTTTTAGTAAAAGG + Intergenic
916426268 1:164683696-164683718 AAAATTTGACAGTAAGTTTCTGG - Intronic
917036273 1:170750514-170750536 GAAATTTCTCCGTAACTAACTGG - Intergenic
917094597 1:171387624-171387646 AATTTTTATCTGAAAGTAACAGG - Intergenic
918328810 1:183436203-183436225 AAAATTTTTTTTTAAGTAGCTGG - Intergenic
920773060 1:208908185-208908207 AAAATTTTTCTGGAAATAATAGG - Intergenic
921845968 1:219882465-219882487 AAAATTTTTCTGGAAGAAAGAGG - Intronic
921896513 1:220407153-220407175 TAAACTTGTCTGTAAGTGATGGG - Intergenic
924473617 1:244364972-244364994 AATATTTCTTTGTAAGAAACTGG - Intronic
1063953715 10:11247206-11247228 AAATTTTGTCTGAAAGTATGTGG - Intronic
1064278424 10:13928990-13929012 GAAATTGATCTGAAAGTAACCGG + Intronic
1065277642 10:24101389-24101411 AAAATTTGTTTTTAAGTATTTGG + Intronic
1069021356 10:63491979-63492001 AAAGTTTCTCTGTAAGGAAAAGG - Intergenic
1069169296 10:65204968-65204990 AAAATTAGTCTGTATATAAAGGG - Intergenic
1069293475 10:66813575-66813597 AAAATTTTTCTGGAAATTACTGG + Intronic
1069809292 10:71146564-71146586 GAAGTTTGTCTGTCACTAACAGG + Intergenic
1071009678 10:80923444-80923466 AAACTTTCTCTGTAAGTGGCTGG + Intergenic
1071284950 10:84135979-84136001 ACAATTTGTCTGTCAGTTTCAGG + Intergenic
1072562964 10:96593580-96593602 AAAGACTGTCTATAAGTAACAGG + Exonic
1073006029 10:100325417-100325439 AAAATATGTCTGAAAGGAAGAGG + Intronic
1073182204 10:101590874-101590896 AATATTTGTCTTTCTGTAACTGG + Intronic
1073742649 10:106426155-106426177 AGACTTTGTCTGGATGTAACAGG + Intergenic
1073882571 10:108000223-108000245 AGCATTTGTCTTTAAGTAAATGG - Intergenic
1073964310 10:108971054-108971076 AAATTCTGGCTGAAAGTAACAGG + Intergenic
1074828346 10:117230883-117230905 GAAACTTGTCTGTAACTAAAAGG - Intergenic
1076121836 10:127942611-127942633 AGTATTTGTCTGTGTGTAACTGG - Intronic
1077361920 11:2144639-2144661 AATATTTGCCTATAAGGAACTGG - Intronic
1079406668 11:20153625-20153647 ACAATTTGTCTTTTTGTAACTGG + Intergenic
1079500771 11:21098868-21098890 AAAATTTGTTTGTAACTCTCAGG + Intronic
1080937412 11:36878988-36879010 AGAAATTGCCTGTAAGTAAAAGG + Intergenic
1080967532 11:37230904-37230926 AGTATTTGTCAGCAAGTAACTGG + Intergenic
1081084801 11:38786473-38786495 GAAATTTGTCTTTCTGTAACTGG - Intergenic
1081247131 11:40781540-40781562 AAAATTTATCTGTAAGTTCAAGG - Intronic
1082908302 11:58338092-58338114 AAACTTTGTCTAAAAGTAAAAGG + Intergenic
1088557499 11:111077512-111077534 AAAATTTCTCTGGAAGTATTAGG + Intergenic
1088705362 11:112457526-112457548 AAAAATTGTCTTCATGTAACCGG + Intergenic
1088821672 11:113462210-113462232 AAAAGATGTCTATAAGGAACAGG + Intronic
1089276436 11:117339264-117339286 AAACTTTTTCTGTAAACAACCGG - Intronic
1090697609 11:129264130-129264152 AATATTTGTCTTTATGTGACTGG - Intronic
1090859034 11:130636735-130636757 AAAATGTGTCTGCAAGCAAGGGG - Intergenic
1091260027 11:134226242-134226264 AAAATTTTTTTGTAATTAGCTGG + Intronic
1091490233 12:926340-926362 AAAATTTTTTTTTAATTAACTGG + Intronic
1091758260 12:3070231-3070253 AAACTTTGTCTGTAAAGAGCCGG - Intergenic
1091924181 12:4330626-4330648 AAACTTTGTCAGAAAATAACTGG - Intronic
1092315775 12:7411896-7411918 AATAGTTGTTTGTAATTAACTGG - Intronic
1092730316 12:11526356-11526378 AAAATTTATATGAAAGTCACAGG - Intergenic
1093187415 12:16036830-16036852 AAAATTGGGCAGTAGGTAACTGG + Exonic
1093293823 12:17363229-17363251 AAAAGTTCTCTGCTAGTAACAGG + Intergenic
1095614706 12:44174403-44174425 AACCTTTTTCTGTAAATAACTGG - Intronic
1095647994 12:44572301-44572323 AAAATTTTTTTTTAATTAACTGG - Intronic
1095771149 12:45958939-45958961 AACACTGGTCTGTAAGAAACTGG - Intronic
1097317606 12:58188781-58188803 GAAATTAGACTGTTAGTAACAGG - Intergenic
1099107444 12:78514481-78514503 AAAATTTATCTGTAAAAAATAGG + Intergenic
1099537563 12:83863420-83863442 AAAAATGGTCTTTAAGTAATGGG + Intergenic
1100160702 12:91857269-91857291 ATAATTTGTCTTTAAGTAAAAGG + Intergenic
1100306719 12:93356720-93356742 AATATTTTTCTGTAAGACACTGG + Intergenic
1100893349 12:99151138-99151160 AAATTTTGTCTTTAAGATACAGG + Intronic
1101720584 12:107347203-107347225 AAAATTTGGCTGAATGTAATTGG - Intronic
1104067664 12:125318923-125318945 AAAATTAGTCTGGAAGTTGCTGG + Intronic
1104499466 12:129271059-129271081 AATCTTTGTATGTAAGTATCTGG - Intronic
1105215436 13:18281440-18281462 AACATTTGTCTGTGTGTTACAGG - Intergenic
1105935401 13:25093992-25094014 AAATTTTGTCTGGAAGGAAAAGG - Intergenic
1106703558 13:32256090-32256112 AATATTTATTTTTAAGTAACGGG - Intronic
1107509134 13:41064189-41064211 AAAATTTAACAGTATGTAACTGG + Intronic
1107829384 13:44360894-44360916 AAAATTTGTCTGTCATAAAAAGG - Intergenic
1108831319 13:54482683-54482705 AAAATTTGTCTGCAAGAATTAGG - Intergenic
1108859157 13:54832075-54832097 AAAATTTGTCTTTCTGTGACTGG - Intergenic
1108886182 13:55185250-55185272 AAAAATTGTCTGTAAGTTATTGG - Intergenic
1109440975 13:62373456-62373478 AAATCTTGTCTGTAAGAAAAGGG + Intergenic
1109616781 13:64844992-64845014 AAAATTTGTCTTAAAGTTATTGG - Intergenic
1110070045 13:71164015-71164037 AAAATGTGTCAGTTACTAACTGG - Intergenic
1110216041 13:73025787-73025809 AAACATTGTCTTTAAATAACAGG + Intergenic
1110941116 13:81350204-81350226 AAAATTTTTCTATCAGTAAAGGG - Intergenic
1111381957 13:87467427-87467449 AAAAGTTGGCTGTAATTACCTGG - Intergenic
1111436648 13:88219485-88219507 AAAATTTGTTTGTTAGAAAGTGG - Intergenic
1113222099 13:108116637-108116659 AAACTCTGTCTGTAAGTACAGGG + Intergenic
1114247051 14:20924004-20924026 CTAATTTGTCTGTAAGTTGCTGG - Intergenic
1114287176 14:21256079-21256101 AAAATTTTTCTGTGATTTACAGG - Intronic
1114325306 14:21583018-21583040 AAAATTGGTCTGTCAGTCACAGG - Intergenic
1114622841 14:24107936-24107958 AATGTTTGTGTGTAACTAACTGG - Intronic
1115231795 14:31168465-31168487 AATATTTGTCTGTAGGTGATTGG - Exonic
1116679651 14:47949748-47949770 AAAATAATTCTGTAAGAAACAGG - Intergenic
1117235427 14:53769576-53769598 TAACTTTGTCTGGAAGTATCTGG + Intergenic
1118197146 14:63637934-63637956 AAAATTTTTCCGTAAGTTATTGG - Intronic
1118642889 14:67808720-67808742 TAAATATGTCTTTAATTAACTGG + Intronic
1118860874 14:69661959-69661981 AAAATTTTTTTTTAATTAACTGG - Intronic
1119651110 14:76383863-76383885 GAAATTTGTCTGTAAACAGCAGG - Intronic
1120054701 14:79909779-79909801 ATCATTTGTCTCTAAGTAAATGG - Intergenic
1120479164 14:85026742-85026764 AGAATTTGTCTTTCAGTAATGGG + Intergenic
1120640278 14:87002329-87002351 GAAAAGTGTCTTTAAGTAACGGG + Intergenic
1120866260 14:89297821-89297843 AAAATTTTTTTTTAAGTCACCGG + Intronic
1120934745 14:89883786-89883808 TAAATTTGTCTATATCTAACAGG - Intronic
1124220266 15:27845045-27845067 AAATTTTGACTTTAGGTAACGGG - Exonic
1125106258 15:35975045-35975067 AAAATTTGTCTGCAAGAAACTGG - Intergenic
1125113813 15:36065168-36065190 TAAATTTGTCTGTAAGATAAAGG - Intergenic
1125118451 15:36123388-36123410 AAAATCTGTTTGTAAGTAAAAGG + Intergenic
1125189311 15:36971451-36971473 TAAATTTGGCCGTAAGAAACTGG + Intronic
1126068394 15:44844266-44844288 AAAATATGTCTGTATTTAGCTGG + Intergenic
1126090437 15:45046539-45046561 AAAATATGTCTGTATTTAGCTGG - Intronic
1128046457 15:64622111-64622133 CAAATTTATCTATAAGAAACAGG - Intronic
1128544918 15:68560454-68560476 AAAAATTGTCTTTAATTAGCTGG - Intergenic
1131546476 15:93320072-93320094 AAGATTTGTAAGTAAGTAGCAGG - Intergenic
1133355485 16:5133576-5133598 AAAAGTTCTCTGTGAGTAGCTGG + Intergenic
1133646740 16:7771476-7771498 AAAAATAGTTTGGAAGTAACCGG - Intergenic
1133881004 16:9782018-9782040 GAAATGTGTCTGCAAGTAACAGG + Intronic
1134409669 16:13993551-13993573 AAAATTTGTTTTTAATTAGCTGG - Intergenic
1136000223 16:27286808-27286830 AAAATTTGTCTCTGAAAAACTGG - Intronic
1138724958 16:59125824-59125846 AAAATTTTTCTGAAAGTCTCAGG - Intergenic
1138936600 16:61733685-61733707 GAAATTTATCTGAAAGTGACAGG - Intronic
1140245894 16:73249128-73249150 AAAATGTGTCTGCAAGTACAAGG - Intergenic
1140335464 16:74100756-74100778 AAAATTTCAATGTAAATAACAGG + Intergenic
1140430841 16:74901476-74901498 AATATTTGTTTTTAATTAACTGG + Intronic
1143043206 17:4055052-4055074 AAAGTTTGCCTGTAAGTGCCAGG - Intronic
1144166063 17:12611868-12611890 AGAATTTGTCTGCTATTAACGGG - Intergenic
1144373384 17:14614694-14614716 AAAATATTTCTGCAAGTGACAGG + Intergenic
1147135614 17:38432362-38432384 AAAATTTTTCTGTAGGTATTGGG - Intronic
1148010009 17:44470929-44470951 ATATTTTGTCTTTAAGTAAGTGG + Intronic
1148639976 17:49180166-49180188 ACACTTTGTTTATAAGTAACAGG - Intergenic
1150886995 17:69098711-69098733 AATATTTGTCTTTTTGTAACTGG - Intronic
1151119623 17:71778256-71778278 AAAATTTATCTTTAAGAAAGAGG + Intergenic
1151234258 17:72707240-72707262 AAAATGTTTCTTTAAGTAGCTGG + Intronic
1153600411 18:6775818-6775840 AAAATTTGTCTGTAAAAGACAGG - Intronic
1153895743 18:9557962-9557984 AAAATTTGTTTTTAAGGAATTGG + Intronic
1156148207 18:34212431-34212453 AAAACATGTGTGTAATTAACAGG - Intronic
1156149933 18:34228878-34228900 AACATTTCTCTGTAAGTCAATGG - Intergenic
1156612533 18:38742082-38742104 AAAATTTGTTTTCAAGTCACTGG + Intergenic
1156926548 18:42587297-42587319 AAAGTATGTCTGTAAGTATTGGG - Intergenic
1159237119 18:65690955-65690977 AATATTTGTCTTTATGTACCTGG - Intergenic
1159566954 18:70062129-70062151 AAAATATGTCTGAGAGTTACTGG + Intronic
1162822808 19:13233647-13233669 AAAAATTGTTTTTAATTAACTGG - Intronic
1164263644 19:23592882-23592904 AAAAGTTGGCTGTAAGTATTTGG - Intronic
1166697762 19:44863516-44863538 AATATATGTATGTAAGAAACTGG + Intronic
925223902 2:2165197-2165219 AAAGTATGTCTGTAAGGAAATGG + Intronic
926578057 2:14604442-14604464 AAATTTTGTCTGTAATTATGTGG - Intergenic
927555213 2:24026122-24026144 AAAATTGGTGTGTAAGTAACAGG + Intronic
928310585 2:30206263-30206285 AAAATTTTTATAAAAGTAACTGG - Intergenic
932194176 2:69768766-69768788 ATAATTTGTCTGCAATTAAAAGG + Intronic
932994011 2:76826567-76826589 GAAATTTATCTGTAAGTGACAGG + Intronic
933452227 2:82469561-82469583 AGAATTTGTCTTTAAGGAAGAGG + Intergenic
933898000 2:86828281-86828303 AAAATTTCTCTACAAATAACTGG + Intronic
934298893 2:91765287-91765309 AACATTTGTCTGTGTGTTACAGG + Intergenic
935275090 2:101469312-101469334 AAAATTTTTTTTTAAGTATCTGG - Intronic
936658862 2:114519769-114519791 TAAATTTGTAAATAAGTAACAGG - Intronic
936695134 2:114937383-114937405 AAAAGTTGCCTGTAAGTATTCGG + Intronic
939749784 2:146028798-146028820 AACATTTCTCTGTAAGGAACAGG - Intergenic
939871997 2:147536088-147536110 AAAATTTATCTGTAATCAAAAGG - Intergenic
941541420 2:166790369-166790391 AAAATTTCTTTGAAAATAACGGG + Intergenic
942014112 2:171793700-171793722 AAGATTCGTCTGCAAGTAGCTGG - Exonic
942533712 2:176940589-176940611 GAAATTTGTCTGTGAGTAGGAGG - Intergenic
942577140 2:177375721-177375743 TAAATTTCTCTGTAAGTTATTGG + Intronic
943015846 2:182509662-182509684 AAAATCTTTCAGAAAGTAACAGG + Intronic
943122847 2:183758649-183758671 AAAATATACCTGAAAGTAACAGG - Intergenic
943210639 2:184961271-184961293 TCAATTTATCTGTAAGTAAAAGG + Intergenic
943616226 2:190095798-190095820 ATAATTTGACTTTATGTAACTGG + Intronic
944946046 2:204686698-204686720 AAGATTTTTCTGAAAGTAGCTGG + Intronic
945376720 2:209085220-209085242 AATATTTGTCCTTATGTAACTGG + Intergenic
946793549 2:223325911-223325933 AAAATTTGTTCCTGAGTAACAGG + Intergenic
947150961 2:227114705-227114727 AAAATATGTATGTACTTAACAGG + Intronic
1169494553 20:6102307-6102329 AAAATTTGTTTCTAAGTCACTGG - Intronic
1169601470 20:7265725-7265747 TAAAGTTGTCTGTAAGTGGCGGG + Intergenic
1170033411 20:11966029-11966051 GTAATGTGTCTGTAAGGAACTGG + Intergenic
1170322286 20:15113686-15113708 AACCTTTGTATGTAAGAAACAGG - Intronic
1170386883 20:15828989-15829011 AAGAATTGTTTGTAAATAACAGG - Intronic
1171471526 20:25375824-25375846 AAAATATGTCTATAATTAGCTGG + Intronic
1174869213 20:54167946-54167968 AATTTTAGCCTGTAAGTAACCGG - Intronic
1175567255 20:59990110-59990132 AACATTTGTCTTTAGGTGACTGG + Intronic
1176514006 21:7769584-7769606 AAAATTTGTTGGTAAGTTAGGGG - Intronic
1177065605 21:16430050-16430072 AATATTTGTTTGAAAGTAATGGG + Intergenic
1178059854 21:28840060-28840082 ATCATTTGGCTGTAAGTATCTGG - Intergenic
1178648119 21:34400108-34400130 AAAATTTGTTGGTAAGTTAGGGG - Intronic
1181787796 22:25239721-25239743 AAACTTTTTCTGTAAAGAACTGG + Intergenic
950331898 3:12162544-12162566 AATATGTGTTTCTAAGTAACAGG - Intronic
951085631 3:18509425-18509447 AAAATATGAATCTAAGTAACTGG + Intergenic
951486303 3:23215275-23215297 ATGCTTTGTCTGTAAGTAAAAGG + Intronic
952507124 3:34017395-34017417 AAAATGTATCTGCAAGTCACAGG - Intergenic
953004323 3:38963859-38963881 AAAATTTTTCTGTAAGTTATTGG - Intergenic
955258359 3:57358532-57358554 AAAGTTTGTTTGCAAGGAACAGG - Intronic
955485710 3:59432824-59432846 AAACTTTGCCTGTAAGGATCAGG + Intergenic
955487182 3:59447094-59447116 AAACTTTATCTCTAAGTAAATGG + Intergenic
956325522 3:68048316-68048338 AAAATTTGTGGGTAAGTAGTAGG + Intronic
957869631 3:86074404-86074426 AAAATTTATCTGTAAATACAAGG + Intronic
958140396 3:89555348-89555370 AATATTTGTGTGTCAGGAACTGG - Intergenic
958552654 3:95636911-95636933 TAAATGTCTCTGTAAGAAACAGG + Intergenic
958581696 3:96034103-96034125 AAAATTTGTCTGTATTAAAATGG - Intergenic
959001234 3:100966489-100966511 AAAATTTTTCTGTAAAAGACTGG - Intronic
959641779 3:108646500-108646522 CAATTTATTCTGTAAGTAACTGG - Intronic
960262131 3:115580109-115580131 AAAATTTTTCTGTAGGGAAGGGG - Intergenic
961775436 3:129280778-129280800 AAAATATGAATGTAAGTGACTGG - Intronic
962292322 3:134147126-134147148 AGAGTTTGTGTGTTAGTAACAGG - Intronic
964752183 3:160062913-160062935 TCAATTTGTCAGTAAGTATCAGG - Intergenic
965321298 3:167254702-167254724 AAAATTTCTTTGAAAATAACGGG + Intronic
965481901 3:169229112-169229134 AAGATTTTACTGTAAGTAAACGG - Intronic
966655555 3:182353869-182353891 AAAAATTGTCTGTACTGAACAGG + Intergenic
967662190 3:192126476-192126498 ACAATATGTTTGTCAGTAACTGG - Intergenic
969106487 4:4810658-4810680 AACATTTGCCTGTAATTAATCGG + Intergenic
970818782 4:20189391-20189413 AACATTTTTCTGTAATTTACTGG + Intergenic
971518554 4:27519548-27519570 AATATTTATCTGGGAGTAACAGG + Intergenic
971800246 4:31280299-31280321 ACTATTTGTCTCTTAGTAACTGG + Intergenic
973243037 4:47978788-47978810 AAAATTTATCTGAAATTAATGGG - Intronic
974079869 4:57200898-57200920 AACCTTTGTCTGGAAGTACCAGG + Intergenic
975385197 4:73749889-73749911 AAAATTTGTCTTGAAGTGAAAGG + Intergenic
975516005 4:75249089-75249111 CAAAGTTGACTGTGAGTAACTGG - Intergenic
976826499 4:89266259-89266281 AAAATTTGTCTGTCCGTTAGGGG - Intronic
977475736 4:97507005-97507027 AAAATTTGTCTCTTATTAGCAGG - Intronic
977768869 4:100832947-100832969 AATATTTATCCGTAAGTAATAGG - Intronic
978035890 4:103994321-103994343 AAAATTTGTTAGAAAATAACAGG - Intergenic
979346758 4:119596302-119596324 AAAATTTATTTCTAAGTAAATGG + Intronic
980379688 4:131996110-131996132 AAAATTTTTCTGTAAGAATCAGG - Intergenic
980473171 4:133275664-133275686 AACATTTGTTTGTAACCAACAGG - Intergenic
980823803 4:138050124-138050146 AAAATTTTTCTGTCTGTATCTGG - Intergenic
981131073 4:141159164-141159186 AAACTTTCTCTGTAAAGAACTGG + Intronic
981206283 4:142044491-142044513 AAAATTCGACTGAAAGTCACAGG - Intronic
983786081 4:171730805-171730827 AAAATTTGTGTGTTTGAAACTGG - Intergenic
983862233 4:172721600-172721622 ATAATTTGTGTGTATGTGACTGG + Intronic
985019753 4:185674962-185674984 AAAATTTGTCTGTGTGTGGCAGG - Intronic
985137786 4:186805294-186805316 AAGATTTGTCTTAAATTAACCGG - Intergenic
986052595 5:4104283-4104305 AAAATCTGTCTGCAAATGACTGG + Intergenic
986446079 5:7822845-7822867 AAAATTTATATGAAAGTCACCGG + Intronic
986805844 5:11308311-11308333 AAACTTTCTCTGTAAATAACTGG + Intronic
986867140 5:12002806-12002828 AAAATTTTTTTTTAAATAACCGG - Intergenic
988175529 5:27718851-27718873 AAAGTTTTTCTGTAGGTATCAGG + Intergenic
988275669 5:29078574-29078596 AATAGTTGTATGTCAGTAACTGG + Intergenic
990151013 5:52817376-52817398 GAAATCTTTCTGTAAGTAATTGG + Intronic
990160447 5:52933342-52933364 AAAATTTGATTTTAAGTAAATGG - Intronic
990322283 5:54641677-54641699 AGAATTATTCTGTAAGTGACAGG + Intergenic
991214216 5:64143433-64143455 AATATTTGTGTTTTAGTAACTGG - Intergenic
991943086 5:71873798-71873820 AAAGTTTTTGTGTATGTAACCGG + Intergenic
992035625 5:72772377-72772399 AAACTTTCTCTGTAAAAAACTGG + Intergenic
992286229 5:75238081-75238103 AAAATTTGTTTTTAATTAGCAGG + Intergenic
992569368 5:78039477-78039499 AAAATTTTTCTGTAAGCGGCTGG + Intronic
993249825 5:85506020-85506042 AAAATTTATCTATTAGTAATTGG + Intergenic
993362546 5:86996157-86996179 AAAATTTGTCTTTCTGTACCTGG + Intergenic
993661339 5:90640089-90640111 AAAATTTTTCTGAAATAAACTGG - Intronic
993864917 5:93181515-93181537 AAAATTGGTCTGTAAAGAAAAGG - Intergenic
994302217 5:98159512-98159534 AAAAGGTGTCTGTAAGAACCAGG - Intergenic
994343176 5:98655641-98655663 AAAAATAATCTATAAGTAACAGG - Intergenic
995227886 5:109723653-109723675 CAAAGTTCTCTGTAAGAAACAGG + Intronic
995647743 5:114331749-114331771 TAAATATATCTGTAAGTAACAGG + Intergenic
996199031 5:120647412-120647434 ATAAATAGTCTGTATGTAACTGG + Intronic
996562829 5:124849221-124849243 TGAACTTGCCTGTAAGTAACAGG - Intergenic
996718309 5:126605332-126605354 AAAATTTTTCTTTAAGGAACTGG + Intronic
996878959 5:128271788-128271810 AAAGTTTGTTTTTAAGTACCGGG - Intronic
997143647 5:131409293-131409315 AATATTTGTCTTTCAGTGACTGG + Intergenic
997154718 5:131541992-131542014 AAAATGTGTATGAAAGTCACTGG - Intronic
998554788 5:143112707-143112729 AACATTTGTCTGTCTGTGACTGG + Intronic
1000201693 5:159017251-159017273 AAAATTAGTCTGTGAGTTGCTGG - Intronic
1000220815 5:159211962-159211984 TAAATTTGTCCTTAAGTACCTGG + Intergenic
1002515679 5:179756600-179756622 GAACTTTATCTGTAAGTAATGGG + Intronic
1004317981 6:14607947-14607969 AATATTTTTCTTGAAGTAACAGG + Intergenic
1005012584 6:21349968-21349990 AAAATTTGTTTTTAAATAACTGG - Intergenic
1005054095 6:21713669-21713691 AATATTTGTCTTTGCGTAACTGG + Intergenic
1005113362 6:22310609-22310631 AAAATATATCTGAAAGTAGCAGG - Intergenic
1005426007 6:25702997-25703019 GAAAATTGTCTGTAATTAAGTGG - Intergenic
1005533423 6:26730923-26730945 AAAGTATGTCTTTAAGTTACTGG + Intergenic
1005537371 6:26770741-26770763 AAAGTATGTCTTTAAGTTACTGG - Intergenic
1006004257 6:30989885-30989907 AATATTTCTCTGTGAGAAACTGG + Exonic
1006232776 6:32598746-32598768 AATATTTGTCTTTCTGTAACTGG - Intergenic
1008854708 6:56068988-56069010 AAAACTTGTTTGCAAGTAACTGG + Intronic
1009438206 6:63642762-63642784 AAAATTTTAGTGTAAGAAACAGG + Intronic
1009717708 6:67422313-67422335 AAAATTTATCTATCAGTTACAGG - Intergenic
1010227273 6:73502590-73502612 AAAATTTATCTTAAAGAAACGGG + Intronic
1010850299 6:80767475-80767497 AAAATTTATTTGAAAGTAGCTGG - Intergenic
1012248055 6:96948438-96948460 AAAATTTTTCTGTAGGTCTCAGG - Intronic
1012488903 6:99756266-99756288 TAAATTTGTTTGTATATAACAGG - Intergenic
1012582990 6:100891085-100891107 AAAATATGACTGTAAGTGATAGG - Intergenic
1013689705 6:112627147-112627169 AAAATTTCAATGTAAGTAATAGG - Intergenic
1014106021 6:117562369-117562391 AAAATTTGTCTTTAAGTGCCAGG + Exonic
1014150235 6:118046030-118046052 AGTATTTGGCTGTAAGTAATTGG - Intronic
1014170393 6:118272565-118272587 AAAATTTGTATCTAGTTAACTGG - Intronic
1014268207 6:119306187-119306209 AAAATTTGTCTGTAAGTAACAGG - Intronic
1014369798 6:120590415-120590437 AAAATTGATCTGTAAGAAAATGG + Intergenic
1015914459 6:138201806-138201828 AAAATTTGTTCGTAAGTTATTGG - Intronic
1018345330 6:162893263-162893285 AAAATTTCTCGGTAAGTTAAGGG - Intronic
1019870199 7:3753653-3753675 AAAATTTGCCTGTGATAAACAGG - Intronic
1020322178 7:6947521-6947543 AAAAGTTCTCTGTGAGTAGCTGG + Intergenic
1020549969 7:9591600-9591622 AAAATTTGTGTGAAACTAAAAGG + Intergenic
1020671933 7:11127056-11127078 AAGATTTGTCTGAGAGTAACTGG - Intronic
1020743019 7:12046139-12046161 AAAAATTGTCTTTTATTAACAGG - Intergenic
1021015948 7:15533587-15533609 AAAATCTGACTCTAAGTAAAAGG - Intronic
1021410782 7:20328553-20328575 ATAACTTGTTTGTAAATAACTGG + Intergenic
1023218633 7:37894549-37894571 AAAATTTATCCAAAAGTAACAGG + Exonic
1023312850 7:38905481-38905503 AAAATTTTTTTATAAGTCACTGG - Intronic
1023527450 7:41119404-41119426 AAAATTTGTCCATAAGTTATTGG + Intergenic
1023747616 7:43336325-43336347 AAAATTTTTTTTTAAGTAGCTGG - Intronic
1024170646 7:46781734-46781756 ACAATTTTGCTGTAAGTAAAGGG - Intergenic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1024468025 7:49734580-49734602 AAAATATTTCTGCAAGAAACAGG + Intergenic
1024767513 7:52677671-52677693 AAAATTATTCTTCAAGTAACTGG - Intergenic
1026281710 7:68928131-68928153 AAAATTTGTCTGTTCCCAACAGG - Intergenic
1028009394 7:85621594-85621616 AAAATTTGTCTTTTAATAATGGG - Intergenic
1028723611 7:94061611-94061633 AAAATCTGTTTGGAGGTAACTGG + Intergenic
1030605548 7:111635510-111635532 AAAATTTGTATGTAACCAAAAGG + Intergenic
1031184750 7:118462135-118462157 AAAAATTATCTCAAAGTAACAGG + Intergenic
1032343970 7:131102879-131102901 AAGATATGTCTGTAATTGACAGG - Intergenic
1033098027 7:138447825-138447847 AAACTTTGTCTAGAAGTACCTGG + Intergenic
1033400594 7:141020214-141020236 AATATTTGTCTTTTAGTGACTGG - Intergenic
1033791254 7:144794968-144794990 AAAATTTTTTTGTATGTGACAGG - Intronic
1034240000 7:149603024-149603046 CATTTTTGTCTTTAAGTAACAGG - Intergenic
1037041347 8:14239355-14239377 AATATTTGAATGTAAGAAACAGG + Intronic
1037352082 8:17971229-17971251 GAATTTGGTCTGTAAGTTACAGG + Intronic
1038432164 8:27509120-27509142 AATATTTGTCTTTTTGTAACTGG + Intronic
1038831539 8:31066582-31066604 AAAATTTTTTTTTAAGTTACTGG - Intronic
1039371892 8:36993307-36993329 TATATTTGTCTCTAAGTAACAGG + Intergenic
1041342351 8:56859065-56859087 AAAATTACTCTGTGAGTGACAGG - Intergenic
1041431796 8:57790261-57790283 ATCAGTTGTCTGTAAGTAAGTGG - Intergenic
1041722509 8:60989023-60989045 AAAAATTGTTTGTAATTAGCTGG - Intergenic
1041749602 8:61245927-61245949 AAAATTTTTTTTTAATTAACTGG - Intronic
1041835554 8:62209462-62209484 AATATTTGTCTTTATATAACTGG + Intergenic
1041839977 8:62257882-62257904 AAAATCTATATGTAAGTAACCGG - Intronic
1042608358 8:70570136-70570158 AACAGTTGGCTGTAAGTATCTGG - Intergenic
1043575976 8:81657050-81657072 AAAATATTTCTTTGAGTAACAGG - Intergenic
1043620627 8:82187794-82187816 AAAAGTAATCTGTAAGTAATAGG + Intergenic
1043705712 8:83347466-83347488 AAAATTTGACAATAAGTAAGAGG + Intergenic
1044372638 8:91430569-91430591 TAAAATTGTCTGTAAGTACCTGG - Intergenic
1045067908 8:98468357-98468379 TACATTTGTCTGTCAGTAGCTGG - Intronic
1045603102 8:103740631-103740653 AAAATATGTGAGAAAGTAACAGG - Intronic
1045778581 8:105836241-105836263 AAAATTTATAAGTAAGTAAAGGG - Intergenic
1046033936 8:108818645-108818667 AACACTTGTCTGTAAGGATCAGG - Intergenic
1047599332 8:126410565-126410587 AAAATGTGTTTGTAGGTAAAAGG + Intergenic
1047639074 8:126798937-126798959 AAAATTTATCTATCAGTATCTGG - Intergenic
1049608855 8:143543009-143543031 AAGATTTGTCTTTTAGTGACTGG - Intergenic
1050723737 9:8621804-8621826 AAAATTTGAGTGTAAATAAAAGG + Intronic
1051749990 9:20330892-20330914 AAAATTTGTTTCTATGCAACAGG + Intergenic
1053084847 9:35210066-35210088 AAAATTTTTTTTTTAGTAACTGG - Intronic
1057663988 9:97028943-97028965 AAAATCTGTGTATAAGTAAGTGG - Intergenic
1060624597 9:125099702-125099724 ATCATGTGTCTGTCAGTAACAGG + Intronic
1060867496 9:127011766-127011788 AAAATTGGTTTGTATGTAACAGG + Intronic
1061171256 9:128956765-128956787 AAAAATTGTATGTCAGTGACTGG + Intronic
1188794397 X:34443656-34443678 AACAGTTGGCTGTAAGTATCTGG - Intergenic
1192378496 X:70588736-70588758 AATATTTGTCTTTTTGTAACTGG - Intronic
1193669708 X:84369166-84369188 AATATTTGTGTTTATGTAACTGG + Intronic
1194220373 X:91182575-91182597 CAAATTTGTAACTAAGTAACCGG + Intergenic
1194609049 X:96018099-96018121 ATAAATTGTCTTTAAGTTACTGG - Intergenic
1195307616 X:103600738-103600760 AAAATTTGACTGTAGGTCCCAGG - Intergenic
1195835201 X:109106904-109106926 AAAATTTGTAGGGAAGTTACTGG - Intergenic
1196255458 X:113513033-113513055 AAACTTTTTCTGTAAAGAACCGG + Intergenic
1196687602 X:118525416-118525438 AAAATTTGTCTTTCTGTGACTGG - Intronic
1197229334 X:123986973-123986995 AAAATTTTTTTTTAAGTAGCTGG - Intronic
1198201591 X:134425047-134425069 AAAATGGGTCTGTAACTAATTGG + Intronic
1199160551 X:144605566-144605588 TCAAGTTGTCTGTAAGTAAAGGG - Intergenic
1200556886 Y:4646327-4646349 CAAATTTGTAACTAAGTAACTGG + Intergenic
1201391955 Y:13508080-13508102 ATCAGTTGTCTGTAAGTATCTGG - Intergenic
1201579717 Y:15498292-15498314 AGAATTTGTCTTTCTGTAACTGG + Intergenic