ID: 1014268699

View in Genome Browser
Species Human (GRCh38)
Location 6:119312111-119312133
Sequence CTGCTGTTCTTGGGGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014268693_1014268699 -5 Left 1014268693 6:119312093-119312115 CCAGTGATACTCATGTCCCTGCT 0: 1
1: 0
2: 1
3: 14
4: 230
Right 1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014268699 Original CRISPR CTGCTGTTCTTGGGGACACA AGG Intronic
No off target data available for this crispr