ID: 1014269003

View in Genome Browser
Species Human (GRCh38)
Location 6:119314802-119314824
Sequence CTGTGAGAATTGAAGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014269003_1014269005 -1 Left 1014269003 6:119314802-119314824 CCTACATCCTTCAATTCTCACAG 0: 1
1: 0
2: 0
3: 22
4: 253
Right 1014269005 6:119314824-119314846 GCCTTCCTCCTCCTCCACTTCGG 0: 1
1: 0
2: 6
3: 55
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014269003 Original CRISPR CTGTGAGAATTGAAGGATGT AGG (reversed) Intronic
900921972 1:5678629-5678651 GTGTGTGAATTGATAGATGTTGG + Intergenic
901989426 1:13100716-13100738 CTGTGGGTTTTGCAGGATGTGGG + Intergenic
901992387 1:13126048-13126070 CTGTGGGTTTTGCAGGATGTGGG - Intergenic
902092120 1:13911884-13911906 TTCTAAGAAGTGAAGGATGTGGG + Intergenic
902539987 1:17147487-17147509 CTGGGAGAATTGGAGAATATTGG + Intergenic
903360682 1:22775186-22775208 TTGTGAAAATAGATGGATGTGGG + Intronic
905697968 1:39989809-39989831 CTGGGAGAAGAGAAGGATGGGGG - Intergenic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908688973 1:66755623-66755645 CTCTGAGAATAGAAAGATTTTGG - Intronic
909142112 1:71880688-71880710 CAGTCAGAATTGAAGGCAGTAGG - Intronic
910763541 1:90758578-90758600 CTGTGAGGAATGAGGGATGCAGG + Intergenic
911804399 1:102187256-102187278 TTTTGAGAATTAAAGGAAGTTGG - Intergenic
912271936 1:108220202-108220224 CTGTCAGAAGTGAGGGATGGGGG + Intergenic
912478251 1:109956892-109956914 TTGTCAGAAGTGAAGGATGGTGG + Intergenic
915728494 1:158035995-158036017 TGTTGAGAATTGAAGGATGATGG - Intronic
915948477 1:160171499-160171521 GGGTGAGAAATCAAGGATGTTGG + Intronic
917508141 1:175647752-175647774 CTGTGTGAATTTAGGGGTGTGGG + Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
919656024 1:200197964-200197986 CTGTGAAAAATGCAGAATGTTGG - Intergenic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
922461033 1:225814586-225814608 CTGTGACTCTTGAAGGCTGTGGG + Intronic
922960773 1:229644095-229644117 CTGTCAGAACTGAAGGGGGTAGG - Intronic
923658465 1:235938561-235938583 CTGTGAGATTTGAAGTAAATAGG - Intergenic
923757900 1:236810146-236810168 GTGTGAGAATTGAGAGTTGTGGG + Intronic
924087380 1:240466838-240466860 CTGTGAACAATGAAGTATGTGGG + Intronic
924467808 1:244314016-244314038 CTGTTAGAATGGAGGCATGTGGG - Intergenic
1063102278 10:2961191-2961213 CTTTGAGATTTGAAGGATGATGG - Intergenic
1064097488 10:12434809-12434831 TTCTGAGACTTGAAGGATGTGGG + Intronic
1064388457 10:14920679-14920701 CTGCTAGAAATGAAGGATGGGGG + Intronic
1064604559 10:17025641-17025663 CTATGAGAAAAGAAAGATGTTGG + Intronic
1065509830 10:26467223-26467245 CTTTGAGAATAGAAGTATGAGGG + Intronic
1065741972 10:28805145-28805167 TTATGAGAAATGAAGGAAGTGGG + Intergenic
1067478979 10:46583453-46583475 CTGTTAGAAATGCAGGATCTTGG - Intronic
1067559502 10:47295027-47295049 GTGTGAGAATTGGAGGATCATGG - Intergenic
1067615759 10:47758348-47758370 CTGTTAGAAATGCAGGATCTTGG + Intergenic
1068246611 10:54379220-54379242 CTGTGAGAAGTGATAGATGGGGG - Intronic
1069925420 10:71847126-71847148 CTATGAGAGTTGAAGTGTGTTGG - Intronic
1072411203 10:95203639-95203661 ATGTGAGAAGTGAAGGATACTGG + Intronic
1073537021 10:104286706-104286728 CTGTCAGAATTGGATGATGAAGG - Intronic
1074835525 10:117289081-117289103 CTGTGAGAAATGAAGAATCTTGG + Intronic
1076271224 10:129153709-129153731 CTGTAAGATTTAAAGGATGGTGG - Intergenic
1076799491 10:132813991-132814013 CTGTGAGGATTCAAGGAGCTGGG + Intronic
1078433773 11:11308029-11308051 CTGGGAGGATTGGAGGAAGTGGG - Intronic
1078561973 11:12380103-12380125 CTGTGAGGAATAGAGGATGTTGG - Intronic
1078911971 11:15740795-15740817 CTGTGTGATTTGAAGAATGGTGG + Intergenic
1081948397 11:47019837-47019859 TTTTGAAAATTGAAGGATTTTGG - Intronic
1082028909 11:47590944-47590966 GTTTGAGAATCCAAGGATGTAGG - Intronic
1083806653 11:65078497-65078519 GTCTGAGTTTTGAAGGATGTAGG - Exonic
1084674401 11:70625655-70625677 CTCTGAGCAGTGGAGGATGTGGG + Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085532048 11:77197743-77197765 CTGGGAGCATTGCAGGCTGTGGG - Intronic
1085557715 11:77440464-77440486 CTGTGAAGATTAAAGGATATAGG - Intronic
1087283387 11:96237761-96237783 CTGTGAGCCTTGAAGAAAGTAGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1091276863 11:134358649-134358671 GTGAGAGAAGGGAAGGATGTAGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1093275707 12:17122583-17122605 TTCTGAGAACTGAAGTATGTGGG + Intergenic
1093407210 12:18819056-18819078 TTGTGAGAAGTGAAGGATAGAGG - Intergenic
1093494875 12:19744989-19745011 ATGTGGTAAATGAAGGATGTGGG - Intergenic
1094359963 12:29620136-29620158 CTGTGAGAATTTCATGATGCTGG + Intronic
1096501347 12:52065574-52065596 CTGTAAGAATTCAGGGAGGTAGG + Intergenic
1097835619 12:64270061-64270083 CTGTGAAAATGGTAGGATTTTGG - Intronic
1099158196 12:79206628-79206650 CTGAGAGCATTGAGTGATGTGGG - Intronic
1100886290 12:99074163-99074185 TTCTCAGAATTGAAGGATGACGG + Intronic
1100938046 12:99692259-99692281 CGGTGAGAATTGAAGAAGGCTGG + Intronic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1104421223 12:128637224-128637246 CTGTGGGGATTGTAGGCTGTGGG - Intronic
1106517530 13:30468050-30468072 CTGAGAGAATTGAAGCATGGAGG - Intronic
1106677627 13:31977965-31977987 CTGTGAGAATAGAATGTTTTGGG - Intergenic
1107108449 13:36671893-36671915 CTCTGACAACTGCAGGATGTTGG + Intergenic
1107233658 13:38142277-38142299 GTGTGATAATTGCAGGATCTCGG + Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1111653247 13:91120113-91120135 CTGTAAGAACTTAAGGATGGAGG + Intergenic
1112110161 13:96287874-96287896 CTGTGAGAATTAAATAATCTAGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1115093319 14:29605054-29605076 GTGTGAGAGATGAAGGAGGTGGG - Intronic
1115220679 14:31055439-31055461 TTGTGAGAATTAAAGGAGTTAGG - Intronic
1115813326 14:37134212-37134234 TTGTGAGACTTGAAGGTTGATGG + Intronic
1119562909 14:75605186-75605208 CTGTGTGGATTGCAGGATGTAGG + Intronic
1120788988 14:88562367-88562389 GTGTGAGAATTCAAGGCTGATGG + Intergenic
1121809846 14:96875000-96875022 CTGTGAGATTTGGGGCATGTCGG + Intronic
1121979437 14:98441936-98441958 CTGTGAGAATTGGAGCTTATGGG - Intergenic
1125078910 15:35653839-35653861 CTGTGTTAATTCAAGGATGGAGG + Intergenic
1125666476 15:41434536-41434558 ATGAGAGAATTGAGGGATGATGG + Intronic
1126481444 15:49125907-49125929 CTGTAAGAATTGGAGGATAAAGG + Intronic
1126714404 15:51499148-51499170 CTGTTAGAATTGATGGATTTAGG - Exonic
1127099824 15:55553155-55553177 CTGTGAGAAGTGATGGATCAGGG - Intronic
1128354047 15:66911884-66911906 CTGTGAGGATTAAATGAGGTTGG + Intergenic
1129047569 15:72749950-72749972 TGGTGAGTATTGAATGATGTTGG - Intergenic
1129126452 15:73445944-73445966 CTGAGAGACTTGATTGATGTGGG + Intronic
1131372657 15:91896035-91896057 CATTGAGAACTGAAGGATTTAGG - Intronic
1131654512 15:94441931-94441953 TTGTGAGAATTCTAGGAGGTAGG + Intronic
1131677011 15:94680880-94680902 CTGAGAGACTGGAAGGATATAGG - Intergenic
1133545071 16:6798338-6798360 TTTTGAGAATTGATGGATTTGGG + Intronic
1134090294 16:11387996-11388018 CTGTGAGATTTGAATGATCAGGG + Intronic
1135741461 16:24978887-24978909 ATGTGAGAATTGAGGCCTGTGGG - Intronic
1135876602 16:26206316-26206338 CTCTGATAACTGGAGGATGTGGG - Intergenic
1137891898 16:52171733-52171755 CAGTTAGGATTGAATGATGTGGG - Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1139150253 16:64373514-64373536 CTTGGACAATTAAAGGATGTTGG + Intergenic
1139764479 16:69215322-69215344 CTGTAGGAATTCAAGGCTGTAGG + Intronic
1141632619 16:85296761-85296783 CTGTAAGAATGGAAGGAGTTAGG - Intergenic
1142038769 16:87879103-87879125 CTGTGAGGATGGAAGTTTGTAGG + Intergenic
1142128214 16:88420588-88420610 CTTTGAGAATTGCAGGATCATGG + Intergenic
1142942833 17:3397177-3397199 CTGTGATAATTTAAGAATGTGGG + Exonic
1143993215 17:10984756-10984778 CTCTGAGACTAGAAGGATTTGGG - Intergenic
1144935071 17:18891188-18891210 CTGGCAGTATTGAAGGATGGAGG + Intronic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1155243718 18:23887289-23887311 CAGCGAGAAGGGAAGGATGTGGG + Intronic
1155490902 18:26400987-26401009 CTGTGAGAACTGAAAGAGCTGGG - Intergenic
1155867103 18:30979231-30979253 ATCTCAGAATTGAAGGCTGTTGG - Intergenic
1157253091 18:46113640-46113662 CTGTGAGAATGACAAGATGTTGG - Intronic
1157671703 18:49535328-49535350 CTGTGACAAGTAAAGAATGTTGG + Intergenic
1157912173 18:51626560-51626582 TTGTGAGGATAGAAGGATGGAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158311192 18:56160363-56160385 CTGTTAGCATTGAAGGCTGCGGG - Intergenic
1158842980 18:61408317-61408339 GTGTGAGAATTGAAGGACAAAGG + Intronic
1162711274 19:12596815-12596837 CTGTGAGAATTGAAGCCTGGAGG - Intronic
1164563524 19:29310082-29310104 CTGTGAGGATTGAAGGAGAAAGG - Intergenic
1166392080 19:42413976-42413998 CTGTGAAAATGGGACGATGTGGG + Intronic
1167327828 19:48836269-48836291 GTGTGAGAAAGGAAGGATGGGGG - Intronic
925686566 2:6479689-6479711 TTGCCTGAATTGAAGGATGTAGG - Intergenic
926392201 2:12404848-12404870 CTGGGTGGAGTGAAGGATGTAGG - Intergenic
926443979 2:12921559-12921581 TAGTGTGACTTGAAGGATGTGGG + Intergenic
926514477 2:13824497-13824519 CAGTGAGCATTGGACGATGTAGG - Intergenic
928124563 2:28606684-28606706 CTGAGAGATTTGGAGGATGGAGG + Intronic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
932384290 2:71316856-71316878 CTTTGAGAATGGAAGCATGTAGG - Intronic
935666770 2:105518976-105518998 CTGTGTGCATTGATGGGTGTTGG - Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
938176598 2:129138214-129138236 CTGTGTTATTTGAAGAATGTAGG - Intergenic
938894776 2:135739182-135739204 CTGAAAGAAGTGAAGGATGGTGG - Intergenic
939091821 2:137788916-137788938 CTGTGAGAATTAAAGTATGATGG + Intergenic
940810812 2:158240766-158240788 CTGTAGGAATTGCAGGATATGGG - Intronic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
944410514 2:199437503-199437525 CTGTGAGAACTGAGACATGTGGG + Intronic
945262791 2:207860342-207860364 CAGGGAGAGTTGAAGCATGTAGG - Intronic
948393763 2:237630025-237630047 CTGTCAGAATTAAAGAAAGTGGG + Intronic
948433204 2:237933865-237933887 CTGTGTGATTTGGAGGATGGCGG - Intergenic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1170008060 20:11690436-11690458 CTGTGTGAATTGATGAATGAAGG - Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173540177 20:43845133-43845155 CTGTGACAATTGTTGGATGAGGG - Intergenic
1173575025 20:44107352-44107374 CAGGGAGAAGAGAAGGATGTGGG - Intergenic
1174141950 20:48421219-48421241 ATGTGAGAAGTGAGGGATGCAGG + Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174365129 20:50052032-50052054 CTCTGAGAATCTAATGATGTGGG + Intergenic
1176381409 21:6115235-6115257 CTGTGAGTATTGAAAAATTTTGG - Intronic
1177044906 21:16157491-16157513 GTTTGAGAATTGAAGTGTGTAGG - Intergenic
1179742063 21:43423004-43423026 CTGTGAGTATTGAAAAATTTTGG + Intronic
1182642559 22:31780211-31780233 CTATAACAATGGAAGGATGTGGG + Intronic
1182716714 22:32362593-32362615 GTGAGAGAATAGAATGATGTGGG + Intronic
1183323974 22:37181379-37181401 ATGAGAGAATTTAAGAATGTTGG + Exonic
1183609077 22:38884997-38885019 CTGTGTGAATTTAAGGGTGCTGG + Intergenic
950987589 3:17391643-17391665 CAGTGAGAAATTAAGGCTGTGGG + Intronic
951422919 3:22509330-22509352 CCCTGAGTATTGAAGGATGAAGG - Intergenic
958767603 3:98388205-98388227 CTGAGGGCATTGTAGGATGTGGG + Intergenic
958988434 3:100811571-100811593 CTTTAAGAATTCAAGAATGTTGG + Intronic
959210184 3:103368988-103369010 CTGAGAGAAGTGAAGAAGGTGGG - Intergenic
959597850 3:108147147-108147169 CTGTGAGAGGCCAAGGATGTGGG + Intergenic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961230528 3:125303495-125303517 CTATGAGAATTTAATGCTGTCGG - Intronic
961640081 3:128359751-128359773 CTGTGAGGATGGAAAGCTGTGGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962377740 3:134872749-134872771 CTGTGATAAGTGCATGATGTGGG - Intronic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
963365034 3:144323717-144323739 CTCTGAGAATTGCTGGATTTAGG + Intergenic
963405879 3:144863347-144863369 CAGTGAGAATTGATTGAGGTAGG - Intergenic
966183017 3:177204035-177204057 CGGTGAGAATTCAAGCATGGCGG + Intergenic
968926694 4:3552034-3552056 CTGTGAGAACTGAAGGGACTGGG - Intergenic
970618235 4:17788429-17788451 AACTGAGAATTGAAGGATTTTGG - Intergenic
973887338 4:55336629-55336651 CTGTGATAACTGAAAAATGTGGG + Intergenic
975248711 4:72151386-72151408 CTGTGAGTATTAAATGATGGGGG + Intergenic
976848526 4:89517737-89517759 CTCAGAGAATAGAAGGATGGAGG - Intergenic
976879451 4:89901082-89901104 CTGAGAGAATTGAGGTATGAAGG + Intronic
977514659 4:98006405-98006427 CTGTGAGAAGTGAAGGCACTAGG + Intronic
978436359 4:108688985-108689007 CTGTGGGACTTGAAGTGTGTTGG - Intergenic
978991962 4:115095087-115095109 CTGTAAGATTTGAATGAGGTGGG - Intronic
980883213 4:138734700-138734722 CAGTGAGAATAGAAGAGTGTGGG + Intergenic
981626635 4:146763988-146764010 ATGTGAGAATTGAGTGAGGTAGG - Intronic
982197140 4:152927995-152928017 CTGAGAGACTTGCAGGATGAGGG - Intergenic
982499346 4:156133403-156133425 GTGTGAGAGTTGAAGTCTGTTGG - Intergenic
982595488 4:157378434-157378456 CTGTGAAAATTTAAGGACTTAGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
989202868 5:38782999-38783021 CTCTCAGAATTGAAGGCAGTAGG + Intergenic
989348554 5:40457444-40457466 TTGTGAGAATAGCAGGATATGGG - Intergenic
989451309 5:41589290-41589312 CTGAGAGAATTTAAGGAATTGGG - Intergenic
991595620 5:68302401-68302423 AGGCGAGAATTGAAGGATGATGG - Intergenic
992606883 5:78466593-78466615 CTAGGAGAATTGTAGGTTGTTGG + Intronic
993130079 5:83885713-83885735 CTGTGTGAATGGAACCATGTGGG + Intergenic
993255579 5:85586822-85586844 CGGGGAGAATTGAAGCAAGTTGG - Intergenic
993308606 5:86299803-86299825 CTGTCAGAAGTGAGGGATGGGGG - Intergenic
994338477 5:98598161-98598183 CAGTAAGACTTAAAGGATGTGGG + Intergenic
995139030 5:108713402-108713424 CTTTGAGAATTGAAGTAAATGGG - Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995627637 5:114096714-114096736 CAGTGAGAAATGAAGCCTGTGGG - Intergenic
997407516 5:133663627-133663649 CTGCTAGAGTTGAATGATGTAGG + Intergenic
998026852 5:138824524-138824546 TTGTAGGAATTGAAAGATGTTGG + Exonic
999889962 5:155966715-155966737 CTGTGAGAATTCACTGAAGTTGG + Intronic
1000008739 5:157212173-157212195 TTGTGAGAATTGAATGATTGAGG + Intronic
1000441797 5:161272304-161272326 CTGTCAGAATCAAGGGATGTGGG + Intergenic
1000595613 5:163211894-163211916 CTTTCAGAATTGGAGGATGTGGG + Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1001950161 5:175810809-175810831 CTTTGAGAAGTGAACTATGTAGG - Intronic
1002860114 6:1072625-1072647 CTGTTAAAATTGATGGGTGTTGG - Intergenic
1002964147 6:1945774-1945796 CTGAGTGATTTGAAGAATGTTGG - Intronic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1005126603 6:22453271-22453293 CTCTGAGAATTGAATAATGGAGG - Intergenic
1005850323 6:29815957-29815979 ATGAGAGAGCTGAAGGATGTGGG + Intergenic
1006240006 6:32669403-32669425 ATGTCAGAATTGGAGGATGATGG + Intergenic
1007713281 6:43838383-43838405 CTTTAAGACTTGAAGGCTGTGGG + Intergenic
1007922235 6:45620809-45620831 CTGAAAGAATTGAAGAAGGTGGG - Intronic
1008890021 6:56477285-56477307 CTTTGAGAGTTGAGGGGTGTGGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1009975888 6:70670162-70670184 TTTTGAGAAGTGAAGGAAGTGGG + Intronic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1011143083 6:84181759-84181781 CTGAGAGAAATTAAGGTTGTAGG + Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018977840 6:168579009-168579031 CTGTGAGAATTGAAACCTGTCGG - Intronic
1021703456 7:23342876-23342898 CAGTGAGAATTGAAGCAGGTTGG + Intronic
1022580912 7:31553225-31553247 CTGTGAGTGGTGAGGGATGTGGG + Intronic
1023575561 7:41622660-41622682 CTGTGTGAATGGAAGCTTGTTGG + Intergenic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1024796231 7:53024649-53024671 ATGTTAGAAATGAAGGTTGTTGG + Intergenic
1026599650 7:71766914-71766936 ATGTGAGAAAGGAAAGATGTAGG + Intergenic
1029925095 7:104307383-104307405 CTGTGCTAATTGAAGATTGTGGG - Intergenic
1030465093 7:109890860-109890882 CTGTCAGAATTGAAGTCTCTAGG + Intergenic
1032149858 7:129419174-129419196 CTGTGAATACTGAAGGATCTGGG + Intronic
1033481253 7:141743222-141743244 CTGTGAGAAATAAATGCTGTTGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036481671 8:9145553-9145575 CTGTTAGAAGTGAAGGTTTTGGG + Intronic
1037026609 8:14045881-14045903 CTGAGATAATTGAATGATGGGGG + Intergenic
1037735888 8:21565688-21565710 CTATGTGAATTGAAGGTTTTAGG - Intergenic
1039653300 8:39368336-39368358 CAGTGAGAATTGTAGAATGATGG + Intergenic
1039792658 8:40887987-40888009 CCCTGAGCATTGAAGGATGAGGG - Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041675737 8:60537640-60537662 CTCTTAGAATTGTAGGATGTCGG - Intronic
1042640834 8:70932469-70932491 CTGTTAGAAGAGAAGGAGGTAGG + Intergenic
1042787348 8:72563551-72563573 CTGTGAGGATAGAAAGATCTAGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044149030 8:88751187-88751209 CTGTGATTACTGAAGGATTTGGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1046324454 8:112622222-112622244 TTTTGAGAATTGAAGAATATTGG - Intronic
1046395659 8:113634943-113634965 CTGGGAGAATTGAAGCATTGTGG + Intergenic
1046782606 8:118231693-118231715 CACTGAGGATAGAAGGATGTAGG + Intronic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1047958487 8:129993904-129993926 GTGGGAGAATTGAGGGAGGTAGG - Intronic
1048330681 8:133468787-133468809 CTGTTAGAAATGCAGGATTTCGG - Intronic
1050195864 9:3083937-3083959 CTGGGAGAATTGGGAGATGTTGG - Intergenic
1050363148 9:4850352-4850374 CTGTGATAACTGAAGAATGGTGG + Intronic
1050434292 9:5592833-5592855 CTGTTAGAATTGCAGAATATTGG - Intergenic
1050507252 9:6360966-6360988 CTATCAGACTTGAAGAATGTAGG - Intergenic
1050928770 9:11298893-11298915 CTCTGAGAATAGAAGCCTGTGGG + Intergenic
1052563885 9:30121720-30121742 CTGAGAGAATTGAACGACGGAGG + Intergenic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1057762494 9:97888153-97888175 CAGGGAGTATTGAAGGATGCAGG + Intergenic
1058070609 9:100597626-100597648 CTGTGAGGGCTGAAGGATGAAGG - Intergenic
1058447322 9:105065628-105065650 AGGTGAGAATTGAAGGATCATGG - Intergenic
1059697622 9:116743925-116743947 CTGTGAGAATGGATGGTTATAGG + Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1186872955 X:13790405-13790427 TTGTGAGAAATAAAGAATGTTGG + Intronic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1187793674 X:22978356-22978378 CTTTGAGAATTAAGGGAAGTCGG - Intergenic
1188043042 X:25392715-25392737 CTTTGAGAAGAAAAGGATGTGGG + Intergenic
1190284475 X:48953119-48953141 ATGAGAGAATTGAGGGATGATGG + Intronic
1196976516 X:121163562-121163584 TTTTGAGAATTAAAGGATATAGG - Intergenic
1197303930 X:124817472-124817494 CTGTGAGAATCCCAGGATATAGG - Intronic