ID: 1014270415

View in Genome Browser
Species Human (GRCh38)
Location 6:119330051-119330073
Sequence TACAGGATGTGCAGAGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014270415_1014270420 24 Left 1014270415 6:119330051-119330073 CCACTTACTCTGCACATCCTGTA 0: 1
1: 0
2: 0
3: 17
4: 240
Right 1014270420 6:119330098-119330120 AAGCCCTTGACTCTTTGTACAGG No data
1014270415_1014270417 -5 Left 1014270415 6:119330051-119330073 CCACTTACTCTGCACATCCTGTA 0: 1
1: 0
2: 0
3: 17
4: 240
Right 1014270417 6:119330069-119330091 CTGTAAATGTTGATGTTCCTTGG No data
1014270415_1014270418 -4 Left 1014270415 6:119330051-119330073 CCACTTACTCTGCACATCCTGTA 0: 1
1: 0
2: 0
3: 17
4: 240
Right 1014270418 6:119330070-119330092 TGTAAATGTTGATGTTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014270415 Original CRISPR TACAGGATGTGCAGAGTAAG TGG (reversed) Intronic
901272731 1:7965612-7965634 TACAGAATGTGCTTAGTAAGTGG + Intronic
901654903 1:10763580-10763602 TATAGGAGGAGCAGAGTCAGGGG - Intronic
903180516 1:21602803-21602825 TACAGGAGGTGCAGGAGAAGAGG - Exonic
907376630 1:54049183-54049205 CAAAGGTTGTGCAGAATAAGTGG - Intronic
909270161 1:73613636-73613658 TAATGGATGTAGAGAGTAAGAGG - Intergenic
910117713 1:83750888-83750910 CACCAGATGTGCAGAGAAAGGGG + Intergenic
910785628 1:90995047-90995069 TACATGATATGCAAAGAAAGAGG + Intronic
913267384 1:117058532-117058554 TACAGGATTTGCAGAAAGAGGGG - Intergenic
914898450 1:151697693-151697715 GAAAGGAAGTGCAGAGGAAGGGG - Exonic
915797885 1:158755987-158756009 TACAGGCTGTGGATGGTAAGTGG + Intergenic
918163951 1:181926574-181926596 AACCGGATCTGCAAAGTAAGAGG - Intergenic
918249256 1:182686850-182686872 TACAGGAGGAGCAGAGAAAGAGG + Intergenic
918604133 1:186401029-186401051 TTCAGGATTTGCAGGGTATGGGG + Exonic
919935723 1:202249361-202249383 TATAGGATGGGCAGGGGAAGAGG - Intronic
922904476 1:229163591-229163613 CACAGGATGTGCAAAGCAGGAGG + Intergenic
922920757 1:229300864-229300886 TGGAGGATGAGCAGAGGAAGAGG + Intronic
923742994 1:236672925-236672947 GACAGGCTTTGCAGAGGAAGTGG - Intergenic
923910807 1:238441701-238441723 TAGAGGATGGGCTGAGTGAGAGG + Intergenic
1064374451 10:14782975-14782997 GACAGGAGGGGCAGAGGAAGGGG + Intergenic
1065169682 10:23014075-23014097 GCCAGAATGTGCAGAGGAAGAGG - Intronic
1065351542 10:24800008-24800030 TACAGCTTGTGAGGAGTAAGAGG - Intergenic
1066146937 10:32569907-32569929 TAAAGAATGAGCAGAGCAAGAGG - Intronic
1067191387 10:44071052-44071074 TACATGCTGTGAAGAGTAAAAGG - Intergenic
1073714902 10:106093003-106093025 GATAGGGTGTGCAGAGAAAGGGG + Intergenic
1074129070 10:110557183-110557205 TACAGGATGTGCACCACAAGGGG + Intergenic
1075277602 10:121108717-121108739 TACAGGATGTGCTGATTGACTGG + Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1077868569 11:6242592-6242614 TACAGGATGTGGAGCTTGAGGGG - Intronic
1077975048 11:7239230-7239252 AACAGGAAGTGCAGAAGAAGGGG + Intronic
1078129536 11:8601890-8601912 AAGAGGATGTGCAGAGGCAGTGG - Intergenic
1081173570 11:39897838-39897860 TACTGGATATTCAGTGTAAGTGG - Intergenic
1081263520 11:40990057-40990079 TATAGTATCTGCAGGGTAAGAGG + Intronic
1082799885 11:57406692-57406714 TTAAGGATGTGGAGAGGAAGAGG + Intronic
1083195193 11:61081862-61081884 TACAGGATGTGTGGAGAAAATGG - Intergenic
1085718630 11:78894576-78894598 TAAAGGATTTCTAGAGTAAGAGG + Intronic
1087627744 11:100616151-100616173 TACAGGATGTACAGAATTAGAGG - Intergenic
1088789034 11:113208044-113208066 GACTGAATGTGCAGAGGAAGGGG - Intronic
1090109979 11:123896847-123896869 TAGAGGCTGGGAAGAGTAAGGGG + Intergenic
1095287464 12:40431077-40431099 TACAGGATGGGGAAAGTAAGAGG + Intronic
1095381607 12:41601102-41601124 TGCAGGGAGTGCAGAGTAGGAGG + Intergenic
1098335879 12:69403995-69404017 TACAGAATGAACAGAGGAAGAGG - Intergenic
1099491273 12:83291797-83291819 TACAGGATTTGGAGAGGAGGTGG + Intergenic
1100906960 12:99312389-99312411 TACAGTATCTGCATAGGAAGTGG + Intronic
1101476609 12:105055517-105055539 TACAAGACGTGCAGAGAAACAGG + Intronic
1101724568 12:107378301-107378323 CAAATGATGTGCAAAGTAAGGGG - Intronic
1101773246 12:107771057-107771079 CACATGATGTGCAGGGTATGGGG - Intergenic
1101853059 12:108420023-108420045 TAGAGGCAGGGCAGAGTAAGGGG + Intergenic
1101999168 12:109545907-109545929 TTCAGGGTGTGCTGAGTAAAGGG + Intergenic
1102702578 12:114852394-114852416 ACCAGGGTGTGCAGAGGAAGGGG - Intergenic
1105533336 13:21240755-21240777 CACAGGAAGTGCTCAGTAAGTGG + Intergenic
1105932554 13:25066580-25066602 TAGAAGGTGTTCAGAGTAAGAGG + Intergenic
1106306388 13:28514996-28515018 TACATGATGTGCTGGGTAAAAGG + Intergenic
1106957053 13:34951353-34951375 TACAGGTTGTACAGATTAAATGG + Intronic
1107535915 13:41331718-41331740 TTCAGTGTTTGCAGAGTAAGGGG + Intronic
1112963507 13:105158388-105158410 TGGAGGATGGGCAGAGTAGGAGG + Intergenic
1114349938 14:21838562-21838584 AACAGGATTTCCAGAGTGAGAGG + Intergenic
1115304057 14:31915717-31915739 TACAGGATGAGCAGAAAAAGCGG - Intergenic
1122554211 14:102568313-102568335 TCCTGGAGGTGCAGAGGAAGAGG - Intergenic
1122993773 14:105251493-105251515 TACAGGGTATGCAGAGTGGGAGG - Intronic
1124252437 15:28115739-28115761 GAAAGGATGTGAAGAGTTAGAGG - Intronic
1125253090 15:37729059-37729081 TAGAGGCTGGGAAGAGTAAGGGG - Intergenic
1125599840 15:40909438-40909460 GAAAGGAGGTGCAGAGTAAAAGG - Intergenic
1125870504 15:43096706-43096728 TTCTGGATGAGCAGAGAAAGTGG - Intronic
1127568381 15:60215528-60215550 CACAGGGTGTGCAGAGAAGGTGG + Intergenic
1128429078 15:67573659-67573681 TACAGGATGTTTAGAGTTAAGGG + Intronic
1128538948 15:68511647-68511669 TACAGAATGAGCAGAGGAAGAGG + Intergenic
1128687982 15:69701050-69701072 TACAGGCTGTTCAGAGGGAGAGG - Intergenic
1129466744 15:75728346-75728368 GACAGGATGGGCAGAGTGGGAGG + Intergenic
1129720500 15:77875434-77875456 GGCAGGATGGGCAGAGCAAGAGG - Intergenic
1131969938 15:97881755-97881777 AACAGGATGGGCAGAGGCAGAGG + Intergenic
1136545250 16:30950773-30950795 TGCAGGCTGTGCAGATGAAGGGG - Intronic
1141821401 16:86448647-86448669 AACGGCATGTTCAGAGTAAGTGG - Intergenic
1145981920 17:29017914-29017936 CACAGGTTGTGCGGATTAAGAGG + Intronic
1149177921 17:53896697-53896719 TAGAGGTTGGGCAGAGGAAGGGG - Intergenic
1149354176 17:55822672-55822694 TTCAGGATGCACAGAATAAGGGG - Intronic
1149624446 17:58070256-58070278 TAAAGAATGAGCAGAGGAAGAGG + Intergenic
1156875186 18:42001992-42002014 TGCAGGAGGTGTAGAGGAAGTGG + Intronic
1157730992 18:50004139-50004161 TACAAGATGTGGAGAAAAAGTGG + Intronic
1159755670 18:72361045-72361067 AACAGGAAGTGCCGAGTAAAAGG + Intergenic
1160064449 18:75561944-75561966 ATCAGGATGTGCAGATTCAGAGG + Intergenic
1161666599 19:5580824-5580846 TACAGTAGGTGCATAGCAAGTGG - Intergenic
1161916330 19:7231116-7231138 CACAGGCTGTGCCGAGTAAGTGG - Intronic
1165403022 19:35613771-35613793 TGCAGCATGTGCACAGTCAGAGG + Exonic
926291692 2:11536230-11536252 CACAGCATGTGCAGAGTCGGAGG + Intronic
926660898 2:15464835-15464857 TACAGGATGGGGAGCGTGAGGGG - Intronic
927375328 2:22406500-22406522 GAAAGGATGCTCAGAGTAAGGGG + Intergenic
928281643 2:29951687-29951709 TACAGGATTGGAAGAGTATGAGG - Intergenic
929355060 2:41013918-41013940 TGCAGGATATGCAGGGCAAGAGG + Intergenic
929856350 2:45641655-45641677 TAAAAGATGGGCAGAGGAAGAGG + Intergenic
932168589 2:69532331-69532353 CACAGGAGATGCAGAGTAAGAGG + Intronic
932671324 2:73740104-73740126 TACAGGATGTGCACTCTAAATGG + Intergenic
932739286 2:74279464-74279486 TGCAGGATGGGCAGAGGAAGAGG - Intronic
935612244 2:105037820-105037842 TTCAGGACGTGAAGAGAAAGAGG + Intergenic
935736656 2:106111800-106111822 CACAGGATTTTCAGAGTAACAGG + Intronic
937535518 2:122882077-122882099 TCCAGGATGTCCAGAGAAAATGG + Intergenic
941423540 2:165314675-165314697 TAAAGGATTTGTAGAGTAGGAGG - Intronic
941708156 2:168681790-168681812 TAGGGGATGGGCAGGGTAAGGGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
944745814 2:202654616-202654638 TTCAGGCTGTGTACAGTAAGAGG + Intronic
944881316 2:204015673-204015695 TACAGGATGTGGAGTTTTAGGGG + Intergenic
945465343 2:210163075-210163097 AACATGATGTGCTGAGTAAAAGG - Intronic
946135848 2:217646370-217646392 TACAGGATGTGCAGGAAAAGGGG - Intronic
947355644 2:229292394-229292416 TAGAGGATGTGGAGAAAAAGAGG - Intergenic
948136399 2:235639420-235639442 TCCAGGGTGGGCAGAGGAAGAGG + Intronic
948493646 2:238330844-238330866 TCCAGGATGTGCAGTGGAGGGGG - Intronic
948799845 2:240427610-240427632 TGCTGGAGGTGCAGAGAAAGAGG - Intergenic
1169253126 20:4075363-4075385 TCCAGGAACTGCAGTGTAAGCGG + Intergenic
1169662774 20:7998606-7998628 TGTAGGATGAGCTGAGTAAGAGG - Intronic
1170699938 20:18694919-18694941 TACAGTATGTGAAGAAAAAGTGG + Intronic
1170768743 20:19313921-19313943 TAAAGGATGGGCAGAGGGAGAGG + Intronic
1171793258 20:29547618-29547640 GACAGGACGTGCAGAGGAAATGG - Intergenic
1172518818 20:35554372-35554394 TACATGCTGTGGAGAGTAAGTGG + Exonic
1172638822 20:36428614-36428636 TGGAGGATGTGCAAAGAAAGGGG - Intronic
1172944554 20:38677080-38677102 TACAGGATGTCCAGTGACAGGGG - Intergenic
1173743057 20:45416172-45416194 AACAGGACGAGCAGAGCAAGCGG - Exonic
1173825677 20:46046256-46046278 AACAGCATGGGCAGAGAAAGGGG - Intronic
1174984470 20:55434903-55434925 TAGAGCCTTTGCAGAGTAAGAGG + Intergenic
1176146593 20:63568245-63568267 TACAGGGAGTGCAGAATCAGAGG + Intronic
1176991127 21:15497481-15497503 TACAGGAAGAGAAGAGTTAGGGG - Intergenic
1178328919 21:31669683-31669705 AACAGTATGTTCACAGTAAGTGG + Intergenic
1179392751 21:41008895-41008917 TACAGAATGTGGACAGTAAAGGG - Intergenic
1181764115 22:25079079-25079101 TACAGTAGGTGCTGAATAAGTGG + Intronic
1183192652 22:36331651-36331673 AACAGGAAGTACAGAGGAAGGGG + Intronic
950673867 3:14542979-14543001 TTCTGGGTGTGCAGAGGAAGAGG + Intergenic
951625467 3:24657611-24657633 TAGAGGTTGAGAAGAGTAAGGGG - Intergenic
952774679 3:37033314-37033336 TACAGGATGTTCTGCGTAGGCGG - Intronic
953395476 3:42566131-42566153 TTCAGCATGTCCAGAGAAAGGGG + Intronic
953435434 3:42874058-42874080 CACAGGAAGTCCAGAGGAAGGGG - Exonic
953986737 3:47449666-47449688 TGCTGGATGTGCACAGAAAGAGG - Intronic
955163597 3:56489028-56489050 AACAGCATGTGCTGAGTAAGAGG + Intergenic
955594705 3:60576023-60576045 TACAGGGTGTGAAGAGAAGGAGG - Intronic
956740538 3:72272301-72272323 GAAAAGATCTGCAGAGTAAGAGG + Intergenic
956782920 3:72618587-72618609 TACATGATGTGCAGAGAACGGGG - Intergenic
958091086 3:88876983-88877005 TACAGTATAGTCAGAGTAAGTGG - Intergenic
962922580 3:139964440-139964462 TGCAGGATATGGAGAGTCAGAGG + Intronic
965191786 3:165539955-165539977 TGCAGCATGTGCACAGAAAGGGG - Intergenic
966892479 3:184417389-184417411 TCCAGGAAGGGCAGAGGAAGAGG + Intronic
967096057 3:186178278-186178300 TTCAGGCTGTGCAGAGCATGTGG + Intronic
968334191 3:197899693-197899715 CAGAGGCTGTGCAGAGTGAGAGG + Intronic
968354919 3:198099011-198099033 TACAGGATGTGGACAGTGGGAGG + Intergenic
968354926 3:198099061-198099083 TACAGGATGTGGACAGTGGGAGG + Intergenic
968354933 3:198099111-198099133 TACAGGATGTGGACAGTGGGAGG + Intergenic
968354948 3:198099211-198099233 TACAGGATGTGGACAGTGGGAGG + Intergenic
968354980 3:198099461-198099483 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355038 3:198099909-198099931 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355060 3:198100059-198100081 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355073 3:198100159-198100181 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355080 3:198100209-198100231 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355087 3:198100259-198100281 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355096 3:198100309-198100331 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355103 3:198100359-198100381 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355132 3:198100559-198100581 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355159 3:198100809-198100831 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355170 3:198100909-198100931 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355193 3:198101059-198101081 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355230 3:198101309-198101331 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355237 3:198101359-198101381 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355259 3:198101509-198101531 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355272 3:198101609-198101631 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355279 3:198101659-198101681 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355286 3:198101709-198101731 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355295 3:198101759-198101781 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355302 3:198101809-198101831 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355355 3:198102159-198102181 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355393 3:198102409-198102431 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355406 3:198102509-198102531 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355413 3:198102559-198102581 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355420 3:198102609-198102631 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355429 3:198102659-198102681 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355436 3:198102709-198102731 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355461 3:198102909-198102931 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355472 3:198103009-198103031 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355479 3:198103059-198103081 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355489 3:198103159-198103181 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355510 3:198103309-198103331 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355520 3:198103409-198103431 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355531 3:198103509-198103531 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355582 3:198103909-198103931 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355593 3:198104009-198104031 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355622 3:198104209-198104231 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355633 3:198104309-198104331 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355658 3:198104509-198104531 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355669 3:198104609-198104631 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355697 3:198104808-198104830 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355708 3:198104908-198104930 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355733 3:198105108-198105130 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355762 3:198105358-198105380 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355781 3:198105508-198105530 TACAGGATGTGGACAGTGGGAGG + Intergenic
968355832 3:198105858-198105880 TACAGGATGTGGACAGTCGGAGG + Intergenic
972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG + Intronic
972876350 4:43365793-43365815 TACAGAATGTGGGAAGTAAGAGG + Intergenic
974235400 4:59174287-59174309 TACAGAACATGCAGTGTAAGGGG - Intergenic
977750603 4:100605463-100605485 AACAGGAGGTGCAAAGCAAGAGG + Intronic
978537121 4:109774303-109774325 TACAGAATATGGAGAGTGAGGGG + Intronic
980267994 4:130545007-130545029 TACAGTATTTTCAAAGTAAGTGG - Intergenic
983746942 4:171212824-171212846 TACAGGATGAGGAGAATATGAGG + Intergenic
984565203 4:181321501-181321523 TACAGGTTGTTCAGAGGAAATGG - Intergenic
985169385 4:187132309-187132331 TACAGAATCTGCTGAGCAAGAGG + Intergenic
987767785 5:22257168-22257190 TTCAGAAAGTGCAGAGTAAGAGG + Intronic
988171020 5:27655713-27655735 TCCAGAATTTGGAGAGTAAGTGG - Intergenic
989461112 5:41699191-41699213 TACAGGGATTGAAGAGTAAGAGG - Intergenic
992141153 5:73798532-73798554 TACAGCATCTGCAGAGAATGGGG - Intronic
998243678 5:140475347-140475369 TTCAGCATGTGCAGAGGAATAGG + Intronic
998353757 5:141517643-141517665 TACAAGGTGTGTAGAGTATGTGG + Intronic
999052852 5:148542687-148542709 TACAGCATGTTCAGAGAAAGGGG + Intronic
999852725 5:155560233-155560255 TATAGTATGTGCAAAGTAGGAGG + Intergenic
1000667894 5:164021377-164021399 TAGGAGATGTGCTGAGTAAGGGG - Intergenic
1001271731 5:170317647-170317669 TACTGTGTGTGCAGAGTAAATGG + Intergenic
1005362974 6:25049648-25049670 TTCAGCATATGCAGAGTAATGGG - Intergenic
1005478885 6:26235981-26236003 AACAGGTTGTACAGAGAAAGAGG - Intergenic
1007494072 6:42247236-42247258 AGCAGGATGTGCAAAGTCAGAGG + Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1007987672 6:46223526-46223548 TAAAGGATGTGGAGGCTAAGAGG - Intronic
1008774725 6:55024214-55024236 TAGAAGATGTGCAGAGGAAAGGG - Intergenic
1010157841 6:72815414-72815436 TCCAAGATGTGCAGAATATGTGG + Intronic
1010711019 6:79174291-79174313 TCCAGGATGTACAAAGTAGGAGG - Intergenic
1011457313 6:87565780-87565802 GACTCGATGGGCAGAGTAAGAGG + Intronic
1011900510 6:92289209-92289231 TAAAGGATGTAGAGAGTAAAAGG + Intergenic
1013421381 6:109970193-109970215 TACAGGATGGGTAGAGGAAGAGG - Intergenic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1014763189 6:125380954-125380976 TCCAGGAGGTGGAGAGTTAGAGG + Intergenic
1015698936 6:136013361-136013383 TACAGGATTTGGAAAGAAAGAGG - Intronic
1016481527 6:144487005-144487027 TACAATATATGCAGAATAAGAGG - Intronic
1016504394 6:144762423-144762445 CACAGGAGGTGCATAGTAAATGG - Intronic
1017174816 6:151493279-151493301 TCCAAGATGTACAGGGTAAGTGG - Intergenic
1017558617 6:155602610-155602632 TACAGGAGCTCCAGACTAAGAGG + Intergenic
1018873780 6:167802919-167802941 AATAGGATGTGAAGAATAAGAGG - Intergenic
1018885921 6:167937113-167937135 TACAGAAGGTGCAGGGTCAGTGG + Intronic
1020430300 7:8111313-8111335 TACAGGAAGTGTACAGGAAGAGG + Intergenic
1022966013 7:35472865-35472887 TCCAGGATGTGCTCCGTAAGTGG - Intergenic
1023303612 7:38799933-38799955 TGGAGTATGTGCAGAGAAAGAGG + Intronic
1025284732 7:57652212-57652234 GACAGGAAGTGCAGAGGAAATGG + Intergenic
1028013205 7:85675586-85675608 TACAGGTACTGGAGAGTAAGTGG - Intergenic
1032512572 7:132483393-132483415 GACATGATGTACAGAGGAAGAGG - Intronic
1033546562 7:142406466-142406488 TAAAGGATGGGAAGAGTTAGGGG - Intergenic
1033672661 7:143507930-143507952 TACAGGATAGGCAGAGGAAGGGG - Intergenic
1036730255 8:11256611-11256633 GCCAGGATGTGCAGAAAAAGGGG - Intergenic
1038114667 8:24539980-24540002 TAGAGGATGTGCTCAGAAAGTGG + Intergenic
1038594854 8:28879038-28879060 TAGAGGAGGTACAGAGGAAGAGG + Intronic
1042185063 8:66128357-66128379 TACAGGATGGGCAGCGGAATCGG - Exonic
1042263353 8:66883138-66883160 TTCAGGAGGTGGAGAGTGAGAGG + Intronic
1042907299 8:73785001-73785023 TTCAGGATGAGCAGAGTATTTGG - Intronic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043160404 8:76839873-76839895 TACAGGGTTTCCAGAGAAAGTGG + Intronic
1044543322 8:93431727-93431749 TACAGGAGGTCCTGAGGAAGAGG - Intergenic
1045201543 8:99987602-99987624 GACAGCCTGTGGAGAGTAAGTGG - Exonic
1047753115 8:127897393-127897415 CATAGGAAGAGCAGAGTAAGGGG + Intergenic
1057092068 9:92267273-92267295 AACAGGAAGGGCAGAGAAAGAGG - Intronic
1057985857 9:99713051-99713073 TATAGGATTTACAGAGTAATTGG - Intergenic
1058222607 9:102320873-102320895 TAGACGATGTACAGAGTAAATGG + Intergenic
1058261435 9:102837665-102837687 TGTAGGATGTGCAGAAGAAGGGG - Intergenic
1061760051 9:132844586-132844608 GACAGGATTTCAAGAGTAAGAGG - Intronic
1186069881 X:5808130-5808152 CACTTGATGTGTAGAGTAAGTGG - Intergenic
1192265900 X:69538066-69538088 TACAGGATGTGTGGAGTGGGTGG + Intergenic
1192364103 X:70456512-70456534 TGCAGGTTGTCCAGGGTAAGGGG + Intronic
1194554874 X:95344370-95344392 TTCTGGATCTGCAGAGCAAGAGG + Intergenic
1199731053 X:150632547-150632569 TGCAGTGTGTGCAGAGTAGGTGG + Intronic
1200585071 Y:4998983-4999005 TACAGGATAAGCACAGAAAGTGG + Intergenic