ID: 1014270949

View in Genome Browser
Species Human (GRCh38)
Location 6:119335388-119335410
Sequence CCCTTTCCACGCCTTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014270949 Original CRISPR CCCTTTCCACGCCTTTGAAA TGG (reversed) Intronic
900527680 1:3137062-3137084 CTCTTTCCTCACCTGTGAAATGG - Intronic
901533970 1:9870920-9870942 CCTCTTCCAGGCCTTAGAAAGGG + Intronic
902613992 1:17613871-17613893 CGGTTTCCCTGCCTTTGAAATGG + Intronic
902652293 1:17844703-17844725 CCCTTTACCCTCCTTTGAGATGG + Intergenic
903659421 1:24967654-24967676 CGGTTTCCTCGCCTGTGAAATGG + Intergenic
904330807 1:29756885-29756907 CCCTTTCTCCTCCTTTCAAATGG + Intergenic
904472370 1:30743861-30743883 CCCTTTCCACGCCCCTAAACAGG - Intronic
904818641 1:33225243-33225265 CCTTAGCCACCCCTTTGAAATGG + Intergenic
904942284 1:34172735-34172757 CCATTTCTAGGACTTTGAAAAGG - Intronic
906686918 1:47768867-47768889 CAGTTTCCACACCTTAGAAAGGG - Intronic
907574048 1:55509901-55509923 CCCTTTCCTCACCTGTAAAATGG - Intergenic
907912848 1:58841726-58841748 CCATTTCCCCGTTTTTGAAATGG - Intergenic
908855852 1:68427241-68427263 CCCTTTCCTCATCTTTAAAATGG + Intergenic
910940305 1:92525999-92526021 CCCTTTCCAAGACTTTGAGTAGG + Intronic
911056768 1:93715419-93715441 CCTTTTCCTCACCTTTAAAATGG - Intronic
911778989 1:101851624-101851646 CCCTTTCCTCTACTTTGAATTGG - Intronic
912639951 1:111335435-111335457 CCCTTTCTATGACTATGAAAGGG - Intergenic
913401326 1:118437763-118437785 CACTTTCAAAGCCATTGAAATGG + Intergenic
913507077 1:119526867-119526889 ACCATTTCACTCCTTTGAAAGGG - Intergenic
914992205 1:152508558-152508580 CACTGTCCTCGCCTGTGAAATGG - Intergenic
915191436 1:154154243-154154265 CACTTTCCTCGTCTGTGAAATGG + Intronic
918366799 1:183816532-183816554 CCATTTCCTCACCTGTGAAATGG + Intronic
921256234 1:213342190-213342212 CCTTTTGAACGTCTTTGAAAGGG - Intergenic
921426102 1:215002748-215002770 ATGTTTTCACGCCTTTGAAAAGG + Intergenic
1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG + Intronic
1064675022 10:17751781-17751803 CCCTTTTCAAGCACTTGAAAGGG + Intergenic
1064965955 10:21015349-21015371 CCATTTCAACGGCTTTGAGAAGG + Intronic
1065003887 10:21362071-21362093 CCCTTTCCCCTCCTTTGGGAAGG - Intergenic
1067055222 10:43046045-43046067 CCATTTCCTCGCCTGTGAACAGG + Intergenic
1068039605 10:51807384-51807406 CCCTTTCCTCTCCATTGTAAGGG + Intronic
1068179248 10:53499784-53499806 CCCTTTCCTTGCCTAGGAAAGGG + Intergenic
1069664059 10:70143354-70143376 CATTTTCCACGTCTTTGAAATGG - Intronic
1070855176 10:79603004-79603026 CACTCTGCACCCCTTTGAAACGG + Intergenic
1070862087 10:79678896-79678918 TTCTATCCATGCCTTTGAAATGG + Intergenic
1071641975 10:87317727-87317749 TTCTATCCATGCCTTTGAAATGG - Intergenic
1072913152 10:99521400-99521422 CCCTTTCCACTGCTTTGGATGGG + Intergenic
1074494457 10:113967707-113967729 CCCTTTGCCCATCTTTGAAATGG - Intergenic
1076290177 10:129340005-129340027 CCATTTCCCCATCTTTGAAAAGG - Intergenic
1076357479 10:129863832-129863854 CCCTTACATCACCTTTGAAATGG + Intronic
1076700336 10:132269700-132269722 CCCTTGCCTCGCCTTGCAAAAGG + Intronic
1076701094 10:132273176-132273198 GCCTTTCCACTGCTTTGAATAGG + Intronic
1076992580 11:283232-283254 CCATTTCCTCCCCTGTGAAATGG + Intronic
1078866575 11:15303220-15303242 CAGTTTCCACACCTGTGAAATGG - Intergenic
1080081413 11:28222454-28222476 CCCTTTCCTAGCCAATGAAAAGG - Intronic
1080554056 11:33399753-33399775 CCCTTCCCAAACCTTGGAAATGG + Intergenic
1080868704 11:36217538-36217560 CCATTTCCTCACCTGTGAAACGG + Intronic
1081908947 11:46687920-46687942 CGCTTTCCTCACCTTTCAAAAGG - Intronic
1083191838 11:61057625-61057647 CATTTTCCATGCCTGTGAAATGG - Intergenic
1087387093 11:97485343-97485365 ACCTTTCCAAGCCTTTGGAAAGG + Intergenic
1088779804 11:113123415-113123437 CCCTTCCCTTGCCTTGGAAAAGG + Intronic
1092198839 12:6567431-6567453 CCATTTCCACCCCTTCCAAAAGG + Intronic
1092409384 12:8242560-8242582 TCCTTTTCACGACTTTTAAAAGG - Intergenic
1093123973 12:15306683-15306705 CTCTTTCCACCCCTTTCCAAAGG + Intronic
1095912394 12:47441903-47441925 CCCCTCCCAGGGCTTTGAAAAGG + Intergenic
1098728994 12:74008869-74008891 CCCTTTCCACACCATTTGAAAGG - Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1101999999 12:109551430-109551452 CCGTTTCCTCACCTGTGAAATGG + Intergenic
1104719885 12:131039336-131039358 CCATTTCCCCGGCGTTGAAAGGG - Intronic
1104719886 12:131039336-131039358 CCCTTTCAACGCCGGGGAAATGG + Intronic
1106138379 13:26991294-26991316 CAGTTTCCACACCTGTGAAATGG - Intergenic
1107256381 13:38432532-38432554 CTCTTTCCACGCATAAGAAAAGG - Intergenic
1108711976 13:53042377-53042399 CCCTTTCAACTTCTCTGAAAAGG + Intronic
1109657598 13:65414203-65414225 GGCTTTCCACACCTGTGAAATGG + Intergenic
1110322448 13:74175495-74175517 AGCTTTTCATGCCTTTGAAAAGG + Intergenic
1112475222 13:99725727-99725749 ACATTTCCACGCCGCTGAAAGGG + Intronic
1112646561 13:101339656-101339678 CCCTTTCAGCGCCTTTCAACAGG - Intronic
1113036596 13:106056631-106056653 CAGTTTCCTCCCCTTTGAAATGG + Intergenic
1116220840 14:42085473-42085495 CCCTTCCCACCCCTTTACAAAGG + Intergenic
1116700289 14:48232448-48232470 CCTTTTGGAAGCCTTTGAAAAGG + Intergenic
1116977391 14:51131399-51131421 CCCTTTTAATGCCTTTGAGAAGG - Intergenic
1119976437 14:79029449-79029471 CCCTTTCTAAGACTTTGACATGG + Intronic
1120847303 14:89137965-89137987 CAGTTTCCACACCTGTGAAATGG - Intronic
1121937903 14:98037311-98037333 CCATCTCCATGCCTTGGAAATGG + Intergenic
1122634654 14:103124261-103124283 CCGTTTCCCCGTCTTTGAAAAGG - Intronic
1124823880 15:33074227-33074249 CATTTTCCACATCTTTGAAATGG + Intronic
1129235841 15:74223249-74223271 CTCTTTCCCCACCTGTGAAATGG - Intergenic
1131520775 15:93112884-93112906 CCCTTCCCAGGCCTTGGAAAGGG - Intergenic
1132236323 15:100224611-100224633 ACCTTTCCTCGCCTTTGCACTGG - Intronic
1134364868 16:13568017-13568039 CCTTTCCCATGTCTTTGAAAAGG + Intergenic
1136386609 16:29930549-29930571 TCCTTTTCAAGGCTTTGAAATGG - Intergenic
1141485834 16:84339740-84339762 CAGTTTCCACTGCTTTGAAACGG + Intergenic
1143119479 17:4598024-4598046 TCCTGCCCACGCCTTTGTAAAGG - Intronic
1144802918 17:17943539-17943561 CCCTTTCCATGCATTTGCACTGG - Intronic
1144853790 17:18257382-18257404 CCCCTTCCAAGCCTTTGCAAAGG + Intronic
1146308823 17:31751371-31751393 CAGTTTCCACGCCTATCAAATGG - Intergenic
1147757561 17:42779103-42779125 ACCTTTCCAGGGCTTTCAAAAGG + Exonic
1148721690 17:49758018-49758040 TCCTTTCCACTGCTTTAAAAGGG + Intronic
1151038081 17:70824050-70824072 CCCTTTCAAACCCTTTGAAAAGG + Intergenic
1153834294 18:8950260-8950282 CCCTCCCCAGGCCTTGGAAAAGG + Intergenic
1156491272 18:37497883-37497905 CCATTTCCTCACCTGTGAAATGG - Intronic
1157495878 18:48157060-48157082 CCCTCTCCCACCCTTTGAAATGG - Intronic
1161626832 19:5331967-5331989 CAGTTTCCAGGCCTGTGAAATGG - Intronic
1161682847 19:5688617-5688639 CCATTTCCCCACCTGTGAAATGG - Intronic
1162087591 19:8257869-8257891 CCCTTTCCAGGCCTGTAAGATGG + Exonic
1163245557 19:16091824-16091846 CCCTTTCCTCCCCTATAAAATGG + Intronic
1166292333 19:41871177-41871199 CAGTTTCCACGTCTGTGAAATGG + Intronic
1166469404 19:43065487-43065509 CCCTCTCCAGACCTTTGAACTGG + Intronic
1168527753 19:57102355-57102377 CACTTTTCTCACCTTTGAAATGG - Intergenic
929583937 2:43101739-43101761 CCCATTTCCCGCCTGTGAAATGG - Intergenic
935131166 2:100261998-100262020 CACTTTCCTCACCTGTGAAATGG - Intergenic
935669681 2:105544416-105544438 CAATTTCCATGACTTTGAAATGG + Intergenic
937146545 2:119650510-119650532 CCGTTTCCTCATCTTTGAAATGG + Intronic
937228067 2:120381166-120381188 TGCTTTCCACACCTGTGAAATGG - Intergenic
937884285 2:126889469-126889491 CGTTTTCCCCACCTTTGAAATGG + Intergenic
938138851 2:128780563-128780585 CCCTTTCTACCCCTCTGACATGG - Intergenic
938599934 2:132827279-132827301 CCATTTCCATCCCTTTTAAATGG + Intronic
938666811 2:133547089-133547111 CCCTTTCTTTGCCTTGGAAAGGG - Intronic
939226186 2:139367606-139367628 CCCTTTTCACGCATTTTCAACGG + Intergenic
941264758 2:163348002-163348024 TTCTTTCAACGCCTTGGAAATGG + Intergenic
943652382 2:190471330-190471352 CCCTTTCCTCGGCTAGGAAAGGG - Intronic
944328825 2:198440919-198440941 CCCTTTCCATTGCTTTGAAGAGG - Intronic
944777136 2:202978283-202978305 CCCAATCCACGCCACTGAAATGG - Intronic
946059314 2:216927995-216928017 CACTTTCCTTGCCTGTGAAATGG - Intergenic
946724821 2:222652025-222652047 CCATTTCCGCCCCTTTGAAGTGG + Intronic
947800115 2:232923934-232923956 CCCTTTCCACCTCTTTTATAAGG - Intronic
948963483 2:241357576-241357598 CCCTTTCCTCTACTTTAAAACGG - Intronic
1168911988 20:1455664-1455686 CACTTTCCTTGTCTTTGAAACGG + Intronic
1170143967 20:13152803-13152825 CCCTGTTCAACCCTTTGAAAAGG + Intronic
1172005518 20:31816757-31816779 CAGTTTCCACACCTTTAAAATGG + Intergenic
1172026812 20:31954058-31954080 TCATTTCCAAGACTTTGAAATGG + Intergenic
1172316063 20:33955300-33955322 CCCTTCCCCAGCCTTTGCAAAGG - Intergenic
1173972832 20:47165739-47165761 CCCTCTCCAGCCCCTTGAAAGGG - Intronic
1178757967 21:35370862-35370884 CCCTTTCCATACCTGTAAAATGG - Intronic
1178846362 21:36177120-36177142 CCTTTGCCACACCTTAGAAATGG - Intronic
1182114479 22:27747721-27747743 CCTTTTCCTCATCTTTGAAAGGG - Intergenic
1182681867 22:32085798-32085820 TCCTTTCCAAGGCTCTGAAATGG - Intronic
1183242442 22:36668069-36668091 CCATTCCCTCCCCTTTGAAATGG - Intronic
1183971359 22:41479977-41479999 CCCTTTCCAAGCCTCTGAAAAGG + Intronic
1184388309 22:44188638-44188660 CCCTTTCCTCATCTGTGAAATGG - Intronic
1184414273 22:44343112-44343134 CAATTTCCTCGTCTTTGAAACGG + Intergenic
1184462347 22:44646325-44646347 CAGTTACCACGCTTTTGAAATGG + Intergenic
953722717 3:45370092-45370114 GACTTTCCACACATTTGAAAGGG - Intergenic
954832960 3:53438660-53438682 ACCCTTCCAGGGCTTTGAAAGGG + Intergenic
954946188 3:54426387-54426409 GCCTTTCCACTCCTTTTAATGGG + Intronic
955205039 3:56888212-56888234 CCATTTCCACTCCTACGAAAAGG + Intronic
955737914 3:62059135-62059157 CCCTTTCCCAGTCTTTAAAATGG + Intronic
961728758 3:128951677-128951699 CCCTTTCTTCGTCTTTGATATGG - Intronic
962418805 3:135208898-135208920 CCCTCTCCAGGCCTTGGAAGGGG - Intronic
962806441 3:138930716-138930738 ACCTTTCTCCGCTTTTGAAAAGG + Intergenic
963347845 3:144117089-144117111 CCCTTTCCTCACTTATGAAATGG + Intergenic
967327415 3:188255283-188255305 CCGTTTCCTCGTCTGTGAAATGG - Intronic
967685624 3:192412212-192412234 CTCTTTCCAGGCCTTTTATAGGG - Intronic
968073619 3:195803640-195803662 CGATTTCCCCGCCTGTGAAATGG - Intronic
968616441 4:1579600-1579622 CCGTTTCCCCGCCTGTAAAAGGG + Intergenic
969318401 4:6395742-6395764 CGCTTTCCTCCCCTGTGAAATGG + Intronic
969857683 4:10013511-10013533 CAGTTTCCTCGCCTTTAAAAGGG + Intronic
969934650 4:10668583-10668605 CCCTGCCCACACCTTTTAAATGG - Intronic
971826521 4:31630623-31630645 CCCTTTCCTCACCTTTCAATGGG + Intergenic
973233976 4:47876573-47876595 GCCTTTACAGGCCATTGAAAAGG + Intronic
973530599 4:51833713-51833735 TCCTTTCCTCACCTGTGAAAGGG + Intergenic
973595841 4:52489099-52489121 CCTTTTCCACCCATTTGAACTGG - Intergenic
975183638 4:71375974-71375996 ACCTTTCAATCCCTTTGAAAGGG - Intronic
975357473 4:73424923-73424945 CCCTTTCCCAGCCCTAGAAATGG + Intergenic
975379373 4:73680632-73680654 CCATTTTCAAGCCTTTGGAAGGG + Intergenic
975622358 4:76307320-76307342 CCCCTTCCCGGCCTTTGGAAAGG + Intronic
978819220 4:112946153-112946175 GCCTTTCCTCGGCTTTGAGAGGG + Intronic
978855057 4:113385537-113385559 CCCCTTCCATGACTTTGTAAAGG + Intergenic
979158049 4:117423127-117423149 CCCTTTCTACTATTTTGAAATGG - Intergenic
985841024 5:2305905-2305927 CCCCTCCCTGGCCTTTGAAAAGG + Intergenic
987070640 5:14334109-14334131 CGATTTCCTCGCCTGTGAAATGG + Intronic
993484992 5:88472977-88472999 CCCTTTTTACAACTTTGAAATGG - Intergenic
995329825 5:110934207-110934229 CCCTTTCCTAGCCAATGAAAGGG + Intergenic
995431031 5:112077743-112077765 CCCCTTTCAAGACTTTGAAAGGG + Intergenic
997595025 5:135101562-135101584 CTCTCTTCACCCCTTTGAAAGGG - Intronic
999051529 5:148529031-148529053 CCCTTTCCTCATCTGTGAAATGG - Intronic
999087428 5:148905059-148905081 CAGTTTCCACACCTGTGAAATGG + Intergenic
999326065 5:150644476-150644498 CCCATTCCACTCCCTGGAAAAGG - Intronic
1002347834 5:178560374-178560396 CCCTTTCTCCATCTTTGAAATGG + Intronic
1002383565 5:178848858-178848880 CTCTTTCCTCGCCATTGTAAAGG + Intergenic
1002520977 5:179793200-179793222 CCCCTTCCAGGCCTGTGAGATGG - Intronic
1002610457 5:180414625-180414647 ATCTTTCCACTCCTTTCAAAGGG - Intergenic
1003087195 6:3069221-3069243 CCCTTACCAGCCCTTTGAAAGGG + Intronic
1003198968 6:3941299-3941321 CCATTTCAAGGCATTTGAAACGG + Intergenic
1004507376 6:16258005-16258027 CACTTTCCTCACCTGTGAAAAGG + Intronic
1005401275 6:25436832-25436854 CCCTCTCCACTCCACTGAAATGG - Intronic
1006989009 6:38197237-38197259 CAGTTTCCTCGCCTCTGAAATGG - Intronic
1007626445 6:43249006-43249028 CAGTTTCCACACCTGTGAAATGG - Intronic
1008646949 6:53524204-53524226 CCCTTTGCCCACCTGTGAAATGG - Intronic
1012486186 6:99724947-99724969 CCCTTTCCTCCCCTTTCCAAAGG + Intergenic
1013419401 6:109952334-109952356 CAGTTTCCACACCTGTGAAATGG + Intergenic
1014270949 6:119335388-119335410 CCCTTTCCACGCCTTTGAAATGG - Intronic
1014492699 6:122082112-122082134 CCCATTCCTTGCCTTTGAAGGGG - Intergenic
1014665638 6:124233498-124233520 CCCATTCCATGGCTTTGGAAGGG + Intronic
1015660583 6:135569919-135569941 CCCTTCCCTCTCCTTTCAAAAGG + Intergenic
1019151726 6:170010935-170010957 CCCATTCCATTACTTTGAAAGGG + Intergenic
1019564148 7:1671266-1671288 CAGTTTCCACACCTGTGAAATGG + Intergenic
1025090886 7:56063571-56063593 GACTTTGAACGCCTTTGAAATGG + Exonic
1026541788 7:71286171-71286193 CCCTTTCAAGGCCTTAGAAGGGG + Intronic
1029685795 7:102147109-102147131 CTCTTTCCAGGCCTTTGATTGGG + Intronic
1032532988 7:132637236-132637258 CCCTTTCCGTGGCTGTGAAAAGG + Intronic
1037688992 8:21167170-21167192 CTCTTTCCTCACCTGTGAAATGG - Intergenic
1040946521 8:52890873-52890895 CAGTTTCCACGTCTTTAAAATGG - Intergenic
1041674887 8:60527915-60527937 CCCTTTCCTCACCTATAAAATGG - Intronic
1043177568 8:77042081-77042103 CCCTTTCCTTGGCTATGAAAAGG - Intergenic
1044178741 8:89163097-89163119 CCCTTTCCTCGCCAAGGAAAGGG + Intergenic
1048366802 8:133745462-133745484 CCCTTTCCACACAGTTCAAAAGG + Intergenic
1049212826 8:141394605-141394627 CCGTTTCCACACCTGTAAAATGG + Intronic
1050490545 9:6184025-6184047 TCCTATCCAGGCCTTTGTAAGGG - Intergenic
1055687994 9:78798502-78798524 CCCTTTCCTCAACTGTGAAATGG - Intergenic
1057195534 9:93114099-93114121 CCCTTTGCCCACCTGTGAAATGG + Intergenic
1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG + Intronic
1058345975 9:103963053-103963075 CCCCTTCCAAGACTTTGAGATGG - Intergenic
1058504320 9:105653251-105653273 CCCTATCCAGGCCCTGGAAAAGG - Intergenic
1060491619 9:124089314-124089336 ACCTTCCCACGTCTGTGAAATGG + Intergenic
1061194456 9:129100208-129100230 CCCTCTCCACACCTGTAAAATGG - Intronic
1186537571 X:10365617-10365639 CCCTTTGCTCCCCTTTCAAAAGG + Intergenic
1186855427 X:13621566-13621588 CCATTTCCTTGCCTTTGGAAAGG - Intronic
1187286183 X:17906052-17906074 CTCTTTCCAGGGCTTTGGAAGGG + Intergenic
1192349106 X:70341077-70341099 CCTTTTCCTCGTATTTGAAATGG + Intronic
1193363199 X:80599611-80599633 CCCTTTCCTTGGCTATGAAAGGG + Intergenic
1193388932 X:80904555-80904577 CCATTTCCACATTTTTGAAATGG + Intergenic
1193787130 X:85772787-85772809 CCCTTTCCTAGCCAATGAAAGGG - Intergenic
1197432440 X:126383373-126383395 CCCTTTCCATGGCTAGGAAAGGG - Intergenic
1197432441 X:126383373-126383395 CCCTTTCCTAGCCATGGAAAGGG + Intergenic
1197726857 X:129782175-129782197 CAGTTTCCTCGCCTCTGAAAAGG + Intronic
1198230057 X:134680474-134680496 CCATTTCTTTGCCTTTGAAAGGG + Intronic
1200338189 X:155374428-155374450 CCATTTCAAAGCCTTTGCAATGG - Intergenic
1200348280 X:155466264-155466286 CCATTTCAAAGCCTTTGCAATGG + Intergenic